1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry_Shevchenko [17]
3 years ago
10

The development of nuclear power has provided electricity for less money, but at a cost. What may be considered a "cost" of nucl

ear power?
Physics
1 answer:
Jlenok [28]3 years ago
8 0
Nuclear power generates alot of power, ALOT. It requires Uranium and other radioactive substances to power it, which over time can degrade and become depleted. This radioactive waste would have to be placed somewhere, and it accumulates over time slowly. 
You might be interested in
The force on an object is given by the equation F = ma. In this equation, F is the force, m is the mass, and a is the accelerati
Bumek [7]

Answer:

The correct answer is 1242 N

5 0
2 years ago
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC
igor_vitrenko [27]

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

7 0
3 years ago
A woman has a mass of 55 kg on earth. what would be the women's weight on the moon? (The moon’s gravity is 1.6 N).
Alex17521 [72]

Answer:

i dont know the answer sorry have a good day

Explanation:

hsjsjdkdkdkdkdkdk

8 0
3 years ago
How do we know what matter is made of?
saw5 [17]
Because everything is made of atoms and matter is atoms
5 0
3 years ago
Sam moves a box with a force of 400N a distance of 5 meters. How long did it take him to move the box if 20 Watts of power was u
kipiarov [429]

Answer:

<em><u>Work</u></em><em><u> </u></em><em><u>done</u></em><em><u> </u></em><em><u>by</u></em><em><u> </u></em><em><u>sam</u></em><em><u> </u></em><em><u>=</u></em><em><u> </u></em><em><u>force</u></em><em><u> </u></em><em><u>×</u></em><em><u> </u></em><em><u>distance</u></em>

<em><u>=</u></em><em><u> </u></em><em><u>4</u></em><em><u>0</u></em><em><u>0</u></em><em><u>×</u></em><em><u>5</u></em>

<em><u>=</u></em><em><u> </u></em><em><u>2</u></em><em><u>0</u></em><em><u>0</u></em><em><u>0</u></em><em><u>J</u></em>

<em><u>Time</u></em><em><u> </u></em><em><u>=</u></em><em><u> </u></em><em><u>work</u></em><em><u>/</u></em><em><u>power</u></em>

<em><u>=</u></em><em><u> </u></em><em><u>2</u></em><em><u>0</u></em><em><u>0</u></em><em><u>0</u></em><em><u>/</u></em><em><u>2</u></em><em><u>0</u></em>

<em><u>=</u></em><em><u> </u></em><em><u>1</u></em><em><u>0</u></em><em><u>0</u></em><em><u>s</u></em>

Explanation:

<h2>HOPE IT WILL HELP YOU✌✌✌✌✌</h2>
5 0
2 years ago
Other questions:
  • When a balloon is rubbed with human hair, the balloon acquires an excess static charge. This implies that some materials A) cond
    13·1 answer
  • Consider a blackbody that radiates with an intensity i1 at a room temperature of 300k. At what intensity i2 will this blackbody
    14·1 answer
  • A 5000 kg truck traveling at 60 m/s stops in 5 seconds. How much friction was between the truck's tires and the ground? ​
    13·1 answer
  • A 800 kg safe is 2.1 m above a heavy-duty spring when the rope holding the safe breaks. The safe hits the spring and compresses
    15·1 answer
  • Which galaxy is the most stretched out?<br>​
    9·2 answers
  • ¿A que velocidad viaja la luz?
    5·2 answers
  • Pls help me with this problem!!
    15·1 answer
  • Active listening includes all of the following EXCEPT: A. paraphrasing B. clarifying C. ignoring D. empathizing Please select th
    12·1 answer
  • Use Kirchoff first law and second law to derise the expression for the total resistancs​
    11·1 answer
  • 1.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!