1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viva [34]
2 years ago
12

What is the percentage of lithium in lithium carbonate (Li2CO3)?

Chemistry
2 answers:
eduard2 years ago
8 0

The correct answer is

18.78%

:)

ale4655 [162]2 years ago
6 0
Molar mass Li2CO3 = 73.89 g/mol
Molar mass Li = 6.94g/mol Li = 6.94*2 = 13.88g


% LI = 13.88/73.89*100 = 18.78% perfectly correct.
You might be interested in
Which of the following has the greatest influence on the size and force of waves?
svlad2 [7]
Wind speed bc The faster the wind, the longer it blows, or the farther it can blow uninterrupted, the bigger the waves.
3 0
2 years ago
Read 2 more answers
The theory general relativity was discovered by who
svetoff [14.1K]
<span>The theory general relativity was discovered by Albert Einstein </span>
4 0
2 years ago
How can a knowledge of chemistry help you be a more informed citizen?
galina1969 [7]
Terms in this set (28) Explain how knowledge of chemistry can be a more informed citizens? Knowledge of chemistry and other sciences can help you evaluate the data presented, arrive at an informed opinion, and take appropriate action.
8 0
3 years ago
What is the orbital diagram for silicon
Novay_Z [31]

Answer: Silicon the first two electrons will go in the 1s orbital. Since 1s can only hold two electrons the next 2 electrons for Silicon go in the 2s orbital. The next six electrons will go in the 2p orbital. The p orbital can hold up to six electrons.

Hope this helps! :)

7 0
3 years ago
Read 2 more answers
Andrew noticed that the plastic in his chair didnt feel as cold as the metal legs. What statement best explains this observation
qaws [65]

Answer:

Explanation:

Hi! :) You didn't post the statements, but the answer should be something about conduction. Hope this helps!

7 0
3 years ago
Other questions:
  • What is the mass number of an atom which contains 21 electrons, 21 protons, and 24 neutrons?
    12·1 answer
  • A 1000-ml bag of d5w 1/2 ns is to infuse over 8 hours. what is the flow rate of the infusion?
    14·1 answer
  • Methyl orange (HMO) is an acid-base indicator. Its two forms in solution are HMO (red) and MO- (yellow). When HMO is added to di
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What error, if any, would the calculated density of the solid have if the material had a hollow center?
    10·1 answer
  • In a college there are exactly 3000 students, exactly 60% are male. What is the number of female students
    15·1 answer
  • Hat is the oxidation state of each element in the compound CaSO4? Include + or - in your answers as appropriate.
    10·1 answer
  • Can someone help me with questions 4-5 <br> 21 points
    9·1 answer
  • How many molecules are there in 39 grams of water
    6·2 answers
  • The ratio of boys to girls at a school
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!