1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
riadik2000 [5.3K]
3 years ago
15

A solution is prepared by dissolving 0.5636 g oxalic acid (H2C2O4) in enough water to make 100.0 mL of solution. A 10.00-mL aliq

uot (portion) of this solution is then diluted to a final volume of 250.0 mL. What is the final molarity of the diluted oxalic acid solution
Chemistry
1 answer:
zepelin [54]3 years ago
6 0

Answer:

The final molarity of the diluted oxalic acid solution is 0.002504 M

Explanation:

Step 1: Data given

Mass of oxalic acid (H2C2O4) = 0.5636 grams

Volume of the solution = 100.0 mL = 0.100 L

A 10 ml of this solution diluted in 250 ml of solution.

Molecular weight of H2C2O4  = 90.03 g/mol

Step 2: Calculate  initial moles of H2C2O4

Moles H2C2O4  = mass / molar mass

Moles H2C2O4  = 0.5636 grams / 90.03 g/mol

Moles H2C2O4 = 0.00626 moles

Step 3: Calculate molarity of the solution

Molarity = moles / volume

Molarity = 0.00626 moles / 0.100 L

Molarity = 0.0626 M

Step 4: Calculate moles of a 10.00 mL aliquot

Moles = 0.0626 M * 0.010 L

Moles = 0.000626 moles

Step 5: Calculate the new molarity

Molarity = 0.000626 moles / 0.250 L

Molarity = 0.002504 M

The final molarity of the diluted oxalic acid solution is 0.002504 M

You might be interested in
How did Democritus contribute to the development of the atom?
matrenka [14]

Democritus developed the atomic model. He theorized that atoms were specific to the material which they composed. He also believed that the atoms different in size and shape, were in constant motion in a void, collided with each other; and during these collisions, could stick together.

6 0
3 years ago
Choose the selection which correctly characterizes all three of the following substances in terms of whether they are polar or n
ohaa [14]

Answer:

SiH4 is nonpolar and BBr3 is nonpolar and SiF4 is nonpolar.

Explanation:

SiH4 is a non-polar compound. Though the Si–H bonds are polar, as a result of different electronegativities of Si and H. However, as there are 4 electron repulsions around the central Si atom, the polar bonds are arranged symmetrically around the central atom having a tetrahedral shape hence they cancel out making the compound nonpolar.

SiF4 is a nonpolar molecule because the fluorine atoms are arranged symetrically around the central silicon atom in a tetrahedral molecule with all of the regions of negative charge cancelling each other out just like in SiH4.

The 3 bromine atoms all lie in the same plane thus the geometry of the compound will be trigonal planar. The BBr3 will be non polar because the three B-Br bonds will cancel out each others' dipole moment given that they are in the same plane.

4 0
3 years ago
Consider a transition of the electron in the hydrogen atom from n=3 to n=7.
kow [346]

<u>Answer:</u>

<u>For a:</u> The wavelength of light is 1.005\times 10^{-6}m

<u>For b:</u> The light is getting absorbed

<u>Explanation:</u>

  • <u>For a:</u>

To calculate the wavelength of light, we use Rydberg's Equation:

\frac{1}{\lambda}=R_H\left(\frac{1}{n_i^2}-\frac{1}{n_f^2} \right )

Where,

\lambda = Wavelength of radiation

R_H = Rydberg's Constant  = 1.097\times 10^7m^{-1}

n_f = Higher energy level = 7

n_i= Lower energy level = 3

Putting the values in above equation, we get:

\frac{1}{\lambda }=1.097\times 10^7m^{-1}\left(\frac{1}{3^2}-\frac{1}{7^2} \right )\\\\\lambda =1.005\times 10^{-6}m

Hence, the wavelength of light is 1.005\times 10^{-6}m

  • <u>For b:</u>

There are two ways in which electrons can transition between energy levels:

  1. <u>Absorption spectra:</u> This type of spectra is seen when an electron jumps from lower energy level to higher energy level. In this process, energy is absorbed.
  2. <u>Emission spectra:</u> This type of spectra is seen when an electron jumps from higher energy level to lower energy level. In this process, energy is released in the form of photons.

As, the electron jumps from lower energy level to higher energy level. The wavelength is getting absorbed.

6 0
3 years ago
What is the electron configuration of an element with atomic number 15? A. 1s2 2s2 2p6 B. 1s2 2s2 2p6 3s2 3p5 C. 1s2 2s2 2p6 3s2
kipiarov [429]
B 
hopes this helps!!!!!!!!!
4 0
3 years ago
Read 2 more answers
Carbon atoms can be identified based on the # of which subatomic particles
34kurt

Answer: protons and neutrons.

The nucleus is made up of 3 subatomic particles that are protons,neutrons and electrons.  

General notation of an element is _{Z}^{A}\textrm{X}

where, X is the Element, A is the Atomic Mass and Z is the Atomic Number

If we know the number of protons we can easily find out the atomic number of any element because Atomic Number = Number of protons in an element.

And in addition if we know the number of neutrons we can easily find out the atomic mass of an element because

Atomic Mass = (Number of protons) + (Number of neutrons)

If we get to know the atomic number and atomic mass, we can easily tell what element is it by looking from the periodic table.

6 0
3 years ago
Other questions:
  • Based on the research of Albert Einstein, what change would most likely result in stopping the emission of electrons from this m
    6·2 answers
  • help plz Which list is in order from smaller to larger sediment particles? A. sand, silt, clay B. clay, silt, sand C. silt, sand
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Lizzy lost 2.3 lbs of water due to sweating during baseball practice. How much energy is absorbed from Lizzy's body for this pro
    6·1 answer
  • Regarding acids, bases, and pH, which of these statements is true? Choose one: A. Substances that release protons when they diss
    5·2 answers
  • 3.
    9·2 answers
  • Swinging a golf club toward a golf<br> ball and hitting it off the tee.
    5·1 answer
  • Question 1 (1 point) Saved Please choose all that describe a series circuit. (If you did not attend live session and take notes,
    13·1 answer
  • What is the part of plant from where <br>new flowers of fruit grows called​
    13·1 answer
  • Explain why crushed garlic has more flavor when put in food than a whole clove of garlic.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!