1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedaia [141]
3 years ago
11

Can someone help me, please?

Chemistry
1 answer:
VikaD [51]3 years ago
7 0
15. D is correct, exothermic reactions release heat

I am not sure about 16
You might be interested in
What factors affect the vegetation of a place?
ale4655 [162]

Answer:

climate ,soils,nature of the surface and man

7 0
3 years ago
Why does the polyatomic anion OH need to gain
salantis [7]

Answer:Well-known examples are sodium hydroxide (NaOH) with OH- as the polyatomic anion, calcium carbonate (CaCO3), and ammonium nitrate (NH4NO3), which contains two polyatomic ions: NH+ and NO3-. ... The properties of compounds containing polyatomic ions are very similar to those of binary ionic compounds.

Explanation:

5 0
3 years ago
Classify which compounds will dissolve in water and which ones will not dissolve in water.
vredina [299]

Answer:

Dissolves in water: Acetone, 1-propanol, Methanol

Do not dissolve in water: Hexane, Decane

Explanation:

From the principle that like dissolves like,polar substances will dissolve in polar solutions, while non-polar substances will dissolve in non-polar substances.

Water is a polar solution, therefore, polar substances will dissolve in it.From the given options:

Acetone is a polar molecule, therefore, it will dissolve in water.

1-propanol is a polar molecule, therefore, it will dissolve in water.

Hexane is a non-polar molecule, therefore, it will not dissolve in water.

Methanol is a polar molecule, therefore, it will dissolve in water.

Decane is a non-polar molecule, therefore, it will not dissolve in water

6 0
3 years ago
Give 7 and example of how each wave in the EM spectrum in used in our daily lives
bogdanovich [222]
1. it’s use for our food in like microwaves and ovens
2. airplanes are guided by radar waves,
3.the tv is used by electromagnetic waves
4. they are used in heaters,
5.infrared cameras which detect people in the dark
6.Allows airport security to observe the internal contents of objects and luggage using airport scanners
7.doctors use electromagnetic waves in x-rays
8 0
3 years ago
In an experiment Teresa's measures 15.5 mL of water she must have used a
kotykmax [81]

Answer:

transfer pipet that had markings every 0.1 mL.

Explanation:

3 0
3 years ago
Other questions:
  • CHEGG Consider the following reaction: LaTeX: Fe\left(CN\right)_6^{3-}+e^-\longrightarrow Fe\left(CN\right)_6^{4-}F e ( C N ) 6
    10·1 answer
  • The loops in ptolemy’s heliocentric model , and those shown on the video , are called?
    6·1 answer
  • When 50.0 ml of a 0.3000 m agno3 solution is added to 50.0 ml of a solution of mgcl2, an agcl precipitate forms immediately. the
    5·2 answers
  • Ocean exploration is limited by
    8·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • #1: Which scientist is credited with developing the orbital model of the atom?
    8·1 answer
  • when your tires heat up from driving on a hot road the pressure inside of them increase. this is an example of which gas law
    8·1 answer
  • Fill in the chart to identify how scientists represent matter and chemical changes in matter.
    12·1 answer
  • 250 mL of 1.5 M nitric acid is mixed with 250 mL of 2.5 M sodium hydroxide. Calculate the pH of the resulting mixture.
    9·1 answer
  • hii what the procedures of making organic fertilizer and its precautions. can u answer it i kinda need it now
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!