1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tiny-mole [99]
3 years ago
12

How many moles are in 68 grams of copper (II) hydroxide, Cu(OH)2

Chemistry
1 answer:
jarptica [38.1K]3 years ago
8 0

heres your answer mate...

You might be interested in
Something that dissolves in liquid <br><br>solven<br> solute<br> solution ​
Feliz [49]

Answer: solute

Explanation:

6 0
3 years ago
If the internal energy of a system increases but there is no change in temperature, then the system's energy is increasing.
777dan777 [17]

Answer:

kintic

Explanation:

4 0
3 years ago
Read 2 more answers
Q#5 Balance and list the coefficients from reactants to products.
skad [1K]

A. 2Fe_2O_3(s) +3C(s) → 4Fe(s) + 3CO_2(g)

B. 2Al(s) + 3FeO(s) → Fe(s) + 3Al_2O_3(s)

C. 2Al(s) +3H_2SO_4(aq) → Al_2(SO_4)_3(aq) + 3H_2(g)

What is a balanced chemical equation?

An equation that has an equal number of atoms of each element on both sides of the equation is called a balanced chemical equation.

A. 2Fe_2O_3(s) +3C(s) → 4Fe(s) + 3CO_2(g)

B. 2Al(s) + 3FeO(s) → Fe(s) + 3Al_2O_3(s)

C. 2Al(s) +3H_2SO_4(aq) → Al_2(SO_4)_3(aq) + 3H_2(g)

Learn more about the balanced chemical equation here:

brainly.com/question/15052184

#SPJ1

8 0
2 years ago
Read 2 more answers
How do atoms form a new substance?
lubasha [3.4K]
By sharing electeons with each other
if they lose or gain electrons then they only form ions
they cannot lose neutrons as they are locked inside the nucleus
8 0
3 years ago
Which elements, when they have to, can have more than
inn [45]
Elements in the third row can break the octet rule
6 0
3 years ago
Other questions:
  • What is the pH of a solution with a 4.60 × 10−4 M hydroxide ion concentration?
    9·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A certain substance X has a normal boiling point of 117.8°C and a molal boiling point elevation constant =Kb·0.63°C·kgmol−1. A s
    12·1 answer
  • Why is it important for scientists to study other planets?
    12·1 answer
  • 19. When 0.5g of calcium trioxocarbonate (IV) was added to excess dilute
    6·1 answer
  • Each element is defined by the number of​
    13·2 answers
  • Uranium is classified as what type of element?
    6·1 answer
  • If the molar heat of vaporization for water is 40.7 kJ/mol. What is the molar heat of condensation? HELP ME PLEASE!!!
    14·1 answer
  • I will mark brainlest
    9·1 answer
  • How might someone dispute the results of your investigation? How might you counter the argument?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!