1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
13

What is the function of a lyase enzyme?

Chemistry
1 answer:
elena55 [62]3 years ago
5 0

Answer:

c. To facilitate a reaction of one substrate to form two products without the use of water

Explanation:

A lyase is an enzyme that catalyzes - accelerates the chemical reaction - in which a substrate is broken into two molecules. The reaction does not involve hydrolysis or oxidation, so the water molecule is not included in the chemical reaction. Thus, the enzyme facilitates the reaction in which a molecule (substrate) is decomposed into two molecules with the elimination of chemical bonds.

You might be interested in
When the following equation is balanced with the lowest whole number coefficients possible, what is the coefficient in front of
jasenka [17]
2Al + 3ZnCl₂ ----> 3Zn + 2AlCl₃

What is the coefficient in front of AlCl₃? ==>> 2
4 0
3 years ago
How do you explain the relatively high conductivity of tap water compared to a low or zero conductivity for distilled water?
gladu [14]
Tap water contains many dissolved ions that are required to carry an electric current, whilst distilled water contains no or relatively low amounts of dissolved ions. the absence of ions in the distilled water accounts for the low to zero conductivity of the water

hope that helps!
4 0
3 years ago
Read 2 more answers
A gas exerts a pressure of 0.62 atm. Convert this to kPa and mmHg. Be sure to show your work.
IRINA_888 [86]

Answer:

The answer to your question is 0.62 atm = 62.82 kPa = 471.2 mmHg

Explanation:

Data

P = 0.62 atm

P = ? kPa

P = ? mmHg

Process

1.- Look for the conversion factor of atm to kPa and mmHg

 1 atm = 101.325 kPa

1 atm = 760 mmHg

2.- Do the conversions

                  1 atm ----------------- 101.325 kPa

                  0.62 atm ------------  x

                   x = (0,62 x 101.325) / 1

                  x = 62.82 kPa

                   1 atm ------------------ 760 mmHg

                   0.62 atm ------------  x

                   x = (0.62 x 760)/1

                   x = 471.2 mmHg                

4 0
3 years ago
An aluminum block has a density of 2.70 g/mL. If the mass of the block is 24.60 g, find the volume of the substance.
harina [27]

Volume of a substance can be determined by dividing mass of the substance by its density.

That can be mathematical shown as:

Density=Mass/Volume

So, Volume=Mass/Density

Here mass of the substance given as 24.60 g

Whereas density of the substance is 2.70 g/mL

So,

Volume=Mass/Density

=24.6/2.7

=9.1 mL

So volume of the substance is 9.1 mL.

8 0
3 years ago
You mix 285.0 mL of 1.20 M lead(II) nitrate with 300.0 mL of 1.60 M potassium iodide. The lead(II) iodide is insoluble. Which of
SIZIF [17.4K]

Answer:

D. The final concentration of NO3– is 0.821 M.

Explanation:

Considering:

Molarity=\frac{Moles\ of\ solute}{Volume\ of\ the\ solution}

Or,

Moles =Molarity \times {Volume\ of\ the\ solution}

Given :

For potassium iodide :

Molarity = 1.60 M

Volume = 300.0 mL

The conversion of mL to L is shown below:

1 mL = 10⁻³ L

Thus, volume = 300.0×10⁻³ L

Thus, moles of potassium iodide :

Moles=1.60 \times {300.0\times 10^{-3}}\ moles

<u>Moles of potassium iodide = 0.48 moles </u>

For lead(II) nitrate :

Molarity = 1.20 M

Volume = 285 mL

The conversion of mL to L is shown below:

1 mL = 10⁻³ L

Thus, volume = 285×10⁻³ L

Thus, moles of lead(II) nitrate :

Moles=1.20\times {285\times 10^{-3}}\ moles

<u>Moles of lead(II) nitrate  = 0.342 moles </u>

According to the given reaction:

2KI_{(aq)}+Pb(NO_3)_2_{(aq)}\rightarrow PbI_2_{(s)}+2KNO_3_{(aq)}

2 moles of potassium iodide react with 1 mole of lead(II) nitrate

1 mole of potassium iodide react with 1/2 mole of lead(II) nitrate

0.48 moles potassium iodide react with 0.48/2 mole of lead(II) nitrate

Moles of lead(II) nitrate = 0.24 moles

Available moles of lead(II) nitrate = 0.342 moles

<u>Limiting reagent is the one which is present in small amount. Thus, potassium iodide is limiting reagent.</u>

Also, consumed lead(II) nitrate = 0.24 moles  (lead ions precipitate with iodide ions)

Left over moles = 0.342 - 0.24 moles = 0.102 moles

Total volume = 300 + 285 mL = 585 mL = 0.585 L

<u>So, Concentration = 0.102/0.585 M = 1.174 M</u>

<u>Statement A is correct.</u>

The formation of the product is governed by the limiting reagent. So,

2 moles of potassium iodide gives 1 mole of lead(II) iodide

1 mole of potassium iodide gives 1/2 mole of lead(II) iodide

0.48 mole of potassium iodide gives 0.48/2 mole of lead(II) iodide

Mole of lead(II) iodide = 0.24 moles

Molar mass of lead(II) iodide = 461.01 g/mol

<u>Mass of lead(II) chloride = Moles × Molar mass = 0.24 × 461.01 g = 111 g </u>

<u>Statement B is correct.</u>

Potassium iodide is the limiting reagent. So all the potassium ion is with potassium nitrate . Thus,

2 moles of Potassium iodide on reaction forms 2 moles of potassium ion

0.48 moles of Potassium iodide on reaction forms 0.48 moles of potassium ion

Total volume = 300 + 285 mL = 585 mL = 0.585 L

<u>So, Concentration = 0.48/0.585 M = 0.821 M</u>

<u>Statement C is correct.</u>

Nitrate ions are furnished by lead(II) nitrate . So,

1 mole of lead(II) nitrate  produces 2 moles of nitrate ions

0.342 mole of lead(II) nitrate  produces 2*0.342 moles of nitrate ions

Moles of nitrate ions = 0.684 moles

<u>So, Concentration = 0.684/0.585 M = 1.169 M</u>

<u>Statement D is incorrect.</u>

4 0
3 years ago
Other questions:
  • A solution is highly concentrated if there is:
    6·1 answer
  • Large power plants in the United States use __________ generators.
    15·1 answer
  • Dinitrogen pentoxide decomposes to form nitrogen dioxide oxygen, following the equation 2N2O3 - 4NO, + 0,. At
    9·1 answer
  • a 125g bar of aluminum at 22 degrees celsius. determine the final temperature of the aluminum, if the amount of energy applied i
    7·1 answer
  • How many energy level does carbon have
    6·2 answers
  • Augh senpai gimmie your but
    7·1 answer
  • What is the approximate speed of the car if they drove a distance of 91 km in 3 hours?
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Describe what happens in a chemical reaction and how it is balanced.
    12·1 answer
  • What is the formula of sulfur diphosphide
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!