1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
3 years ago
9

Phosphorous pentachloride decomposes according to the reaction

Chemistry
1 answer:
guajiro [1.7K]3 years ago
4 0

Answer: The equilibrium constant, K_c, for the reaction is 0.061.

Explanation:

Initial concentration of PCl_5  = \frac{\text {given mass}}{\text {Molar mass}\times Volume in L}}=\frac{12.3g}{208.2g/mol\times 1.50L}=0.039M  

Equilibrium concentration of PCl_5 = \frac{31.8}{100}\times 0.039=0.012M  

The given balanced equilibrium reaction is,

                            PCl_5(g)\rightleftharpoons PCl_3(g)+Cl_2(g)

Initial conc.              0.039 M                0 M        0 M

At eqm. conc.     (0.039-x) M              (x) M   (x) M

Given : (0.039-x) = 0.012

x = 0.027

The expression for equilibrium constant for this reaction will be,

K_c=\frac{[Cl_2]\times [PCl_3]}{[PCl_5]}

Now put all the given values in this expression, we get :

K_c=\frac{0.027\times 0.027}{0.012}=0.061

The equilibrium constant, K_c, for the reaction is 0.061.

You might be interested in
What reaction type is depicted by the following equation? 2C2H2 + 5O2 4CO2 + 2H2O
Nonamiya [84]
The answer is combustion
3 0
3 years ago
One way the U.S. Environmental Protection Agency (EPA) tests for chloride contaminants in water is by titrating a sample of silv
Flauer [41]

Answer:

1.1 × 10⁻⁴ M

Explanation:

Let's consider the following double displacement reaction.

CuCl₂(aq) + 2 AgNO₃(aq) → 2 AgCl(s)+ Cu(NO₃)₂(aq)

We can establish the following relations:

  • The molar mass of AgCl is 143.32 g/mol.
  • The molar ratio of AgCl to CuCl₂ is 2:1

The moles of CuCl₂ that reacted to produce 7.7 mg of AgCl are:

7.7 \times 10^{-3} gAgCl.\frac{1molAgCl}{143.32gAgCl} .\frac{1molCuCl_{2}}{2molAgCl} =2.7 \times 10^{-5}molCuCl_{2}

The molarity of CuCl₂ is:

M=\frac{2.7 \times 10^{-5}molCuCl_{2}}{0.250L} =1.1\times 10^{-4} M

7 0
2 years ago
Is -280 f degrees hot or cold
N76 [4]

Answer:

COLD

Explanation:

6 0
3 years ago
Read 2 more answers
What is the bronsred base of NO2- +H2O HNO2 +OH-
kramer
Bronsted lowry bases

NO2- amd OH-
4 0
3 years ago
HELPPP TODAY IS THE LAST DAY OF SCHOOL
Alecsey [184]

Answer:

orbiting closer to the earth's surface.....im pretty sure abt it

4 0
3 years ago
Other questions:
  • According to the kinetic molecular theory, which statement describes the particles in a sample of an ideal gas?
    7·2 answers
  • 8. The best way to obtain pure, solid household salt from a solid mixture of household salt and sand is to:
    14·1 answer
  • What is a solution
    13·1 answer
  • Abby fills a graduated cylinder with 3 mL of water. She
    13·1 answer
  • When 1.00 g of thiamine hydrochloride (also called vitamin B1 hydrochloride) is dissolved in water, then diluted to 10.00 mL, th
    7·1 answer
  • Material safety data sheets are used to give the information about a solvent. The excerpt below is part of an MSDS. Which inform
    15·2 answers
  • Which two factors does the power if a machine depend on
    7·2 answers
  • Which one will fill up first?? and explain how?,​
    8·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Convert 100.6 Kelvin to degrees C. <br><br>°C = K - 273 <br>[?] °C ​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!