1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kap26 [50]
3 years ago
10

35.0 grams of nitrogen gas reacts with 60.0 grams of hydrogen gas: N2 + 3H2--> 2NH3

Chemistry
1 answer:
Misha Larkins [42]3 years ago
6 0

Explanation:

Moles of N2 = 35.0g / (28g/mol) = 1.25mol

Moles of H2 = 60.0g / (2g/mol) = 30.0mol

Since 1.25mol * 3 < 30.0mol, nitrogen is limiting.

Moles of NH3 = 1.25mol * 2 = 2.50mol.

Mass of NH3 = 2.50mol * (17g/mol) = 42.5g.

30.0mol - 1.25mol * 3 = 26.25mol.

Excess mass of H2

= 26.25mol * (2g/mol) = 52.5g.

You might be interested in
Question 11 (5 points)
LenKa [72]

Answer:

False

Explanation:

On the left side of the equation (Li + O2), there is 1 Li atom and 2 O atoms.

but on thw right side of the equation (Li2O,) there is 2 Li atoms and 1 O atom

8 0
3 years ago
An object is dropped from a height of 150m. What's the object's terminal velocity (the velocity with which the object hits the g
77julia77 [94]
I used an online calculator and got 54.22 m/s. I hope that helps
8 0
3 years ago
1s22s22p63s23p64s13d10 which element is this
Sholpan [36]

Answer:

Copper

Explanation:

5 0
3 years ago
Explain the difference between an endothermic and an exothermic reaction using the concepts of potential energy, stability, and
kakasveta [241]
An Exothermic reaction releases energy into the surroundings and so the products have more potential energy then the reactants. The enthalpy change is a negative value. Whereas, an endothermic reaction involves the absorption of energy into the system and so the reactants have more potential energy than the products. The enthalpy change is a positive value. This is clearly represented in energy profile diagrams.
4 0
3 years ago
I WILL MARK BRAINLIEST How could this sentence be re-written to convey the active voice?
Fed [463]
C is the answer to this question
5 0
3 years ago
Read 2 more answers
Other questions:
  • Sand and salt are poured into a single beaker. the result is a mixture because
    7·1 answer
  • Certain atoms emit photons of light with an energy of 3.820 ✕ 10−19 J. Calculate the frequency (in Hz) and wavelength (in nm) of
    15·1 answer
  • In a stack of undisturbed rock layers, the upper layers are younger than the lower layers. This is also stated as the law of ___
    7·2 answers
  • Under which of the following sets of conditions would the most o2 (g) be dissolved in h2o(l)?
    14·1 answer
  • The chemical equation below shows the reaction between carbon dioxide (CO2) and lithium hydroxide (LiOH). CO2 + 2LiOH mc011-1.jp
    13·2 answers
  • PLEASE ANSWER
    9·2 answers
  • Gina wants to use models to better understand how the types of bonds in a molecule relate to the presence of geometric isomers.
    13·2 answers
  • 7th grade science lol help​
    14·1 answer
  • A 3 L pocket of air at sea level has a pressure of 100 atm. Suppose the air pockets rise in the atmosphere to a certain height a
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!