Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
C. NaOH ammmonia is also an base but not as strong as NaOH
<span>2AlPO4 ( aq) + 3MgCl2 (aq) -> Mg3(PO4)2 (s) + 2AlCl3 (aq) </span>
<span>Right answer is D
</span>
The first step is to find the number of moles of OH⁻ that reacted with the HCl. To do this multiply 2.00L by 1.50M to get 3 moles of Ca(OH)₂. Then you multiply 3 by 2 (there are 2 moles of OH⁻ per every 1 mole of Ca(OH)₂) to get 6 moles of OH⁻. That means that you needed 6 moles of HCl since 1 mole of HCl contains 1 mole of H⁺ and equal amounts H⁺ and OH⁻ reacted with each other. To find the molarity of the HCl solution you need to divide 6mol by 1L to get 6M. Tat means that the concentration of the acid was 6M.
I hope this helps. Let me know if anything was unclear.
