1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
2 years ago
10

What is a reaction rate?

Chemistry
1 answer:
Kay [80]2 years ago
8 0

Answer:

Reaction rate, in chemistry, the speed at which a chemical reaction proceeds. It is often expressed in terms of either the concentration (amount per unit volume)

Explanation:

You might be interested in
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Which of the following is a strong base?
malfutka [58]
C. NaOH ammmonia is also an base but not as strong as NaOH
3 0
3 years ago
38 points!! >:D
Sav [38]

Answer: which*

Explanation:

8 0
3 years ago
Read 2 more answers
Can someone help me with chemistry?
mihalych1998 [28]

<span>2AlPO4 ( aq) + 3MgCl2 (aq) -> Mg3(PO4)2 (s) + 2AlCl3 (aq) </span>

<span>Right answer is D
 </span>

8 0
3 years ago
Read 2 more answers
A 1.00 L volume of HCl reacted completely with 2.00 L of 1.50 M Ca(OH)2 according to the balanced chemical equation below. 2HCl
Zigmanuir [339]
The first step is to find the number of moles of OH⁻ that reacted with the HCl.  To do this multiply 2.00L by 1.50M to get 3 moles of Ca(OH)₂.  Then you multiply 3 by 2 (there are 2 moles of OH⁻ per every 1 mole of Ca(OH)₂) to get 6 moles of OH⁻.  That means that you needed 6 moles of HCl since 1 mole of HCl contains 1 mole of H⁺ and equal amounts H⁺ and OH⁻ reacted with each other.  To find the molarity of the HCl solution you need to divide 6mol by 1L to get 6M.  Tat means that the concentration of the acid was 6M.

I hope this helps.  Let me know if anything was unclear.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the total gas pressure in a sealed flask that contains oxygen at a partial pressure of 0.35 atm and water vapor at a par
    6·1 answer
  • Please help me solve? Chemistry
    7·1 answer
  • An amino acid is usually more soluble in aqueous solvent at pH extremes than it is at a pH near the isolelectric point of the am
    9·1 answer
  • Herbie left his house at 3:30 p.m. and arrived at Kit’s house at 5:00 p.m. The two boys live 7 miles apart. What was Herbie’s av
    11·1 answer
  • How does a lightning rod protect a<br> building from lightning damage?
    12·2 answers
  • What is the pH of a solution with an [H+] of (a) 5.4 x 10-10, (b) 4.3 x 10-5, (c) 5.4 x 10-7?
    15·1 answer
  • Please Help ASASP i need help
    7·1 answer
  • What can experiments in a lab tell us about substances on Titan?
    11·1 answer
  • In 11.06 grams of C5H11OH how many grams of water can be produced?
    10·1 answer
  • Predict the reaction <br> HCIO4+ KOH=
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!