1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
3 years ago
11

Difference between ntp and stp​

Chemistry
1 answer:
Phantasy [73]3 years ago
8 0

Answer:

STP stands for Standard Temperature and Pressure. NTP stands for Normal Temperature and Pressure.

Explanation:

STP is set by the IUPAC as 0°C and 100 kPa or 1 bar.

NTP is set at 101.325 kPa but uses 20°C as the temperature

You might be interested in
Under what environmental conditions are you most likely to generate static electricity?
ch4aika [34]
If it is a really humid warm day, have you ever noticed that's when all electrical storms occur
4 0
4 years ago
Someone please help!!!
sveticcg [70]

Answer: The last electron will be filled in first orbital of 3p sub-shell.

Explanation: Filling of electrons in orbitals is done by using Hund's Rule.

Hund's rule states that the electron will be singly occupied in the orbital of the sub-shell before any orbital is doubly occupied.

For filling up of the electrons in Sulfur atom having 16 electrons. First 10 electrons will completely fill according to Aufbau's Rule in 1s, 2s and 2p sub-shells and last 6 electrons are the valence electrons which will be filled in the order of 3s and then 3p.

3s sub-shell will be fully filled and the orbitals of 3p sub-shell will be first singly occupied and then pairing will take place. Hence, the last electron will be filled in the first orbital of 3p-sub-shell.

5 0
3 years ago
Express the chemical reaction between hydrogen and oxygen elements for the formation of water in word equation and chemical equa
White raven [17]

Answer:

Two moles of hydrogen gas combine with one mole of oxygen gas to produce two moles of water.

2H_{2} O + O_{2}  -> 2H_{2}O

Explanation:

This is the required amount of each element to synthesize water. The equation has been balanced using coefficients.

7 0
3 years ago
What is the volume (in ml) of a 12.9 g piece of metal with a density of 7.25 g/cm3?
Leto [7]
Hey there:

1 cm³ = 1 mL

D = m  / V

7.25 = 12.9 / V

V = 12.9 / 7.25

V = 1.779 cm³
6 0
3 years ago
Read 2 more answers
200.0ml of a .800 M solution of sodium phosphate is reacted with excess lead acetate as shown below. How many grams of lead phos
Julli [10]

Answer:

The mass of the solid precipitate (HgSO₄) is 27.529 g

Explanation:

I did the test

4 0
3 years ago
Other questions:
  • The function gx=(x-2)2. The function fx=gx+3
    10·1 answer
  • 1.72 mol of LiCl in 37.5 L of solution
    9·1 answer
  • 2 PUNTIS
    6·1 answer
  • A beaker contains 450 g of water (H2O). If 9.2 g of calcium fluoride (CaF2) is added, what is the molality concentration of the
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • If you had 100 ml of juice how many milliters would be fruit juice
    7·1 answer
  • ANSWER ASAPP<br> What is a compound?
    5·2 answers
  • What is the science definition of conductive
    5·1 answer
  • A naturally occurring oil co-distills with water to produce an oil/water distillate that is 20% oil by weight. If the molecular
    8·1 answer
  • the highest concentration of life extorts in the top 200 meters of ocean water what is the most important factor that influences
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!