1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
13

Why is it difficult to undergo nucleophilic substitution in haloarene?​

Chemistry
1 answer:
goldenfox [79]3 years ago
8 0

Answer:

In Haloarenes the C atom to which the X group is attached is SP2 hybridized thus it is become difficult to replace it by the Nucleophile. Since arenes and Vinyl halides are electron rich molecules due to presenceof n bonds, they repel Nucleophile attacking them.

You might be interested in
Why do scientist study volcanos!!
agasfer [191]

Answer:

Volcanologists use many different kinds of tools including instruments that detect and record earthquakes (seismometers and seimographs), instruments that measure ground deformation (EDM, Leveling, GPS, tilt), instruments that detect and measure volcanic gases (COSPEC), instruments that determine how much lava is moving underground (VLF, EM-31), video and still cameras, infrared cameras, satellite imagers, webcams, etc!

Explanation:

I HOPE IT HELPED

6 0
3 years ago
Water can form a solution by mixing with:
MA_775_DIABLO [31]

Explanation:

Solid, liquids and gases

8 0
3 years ago
Read 2 more answers
A. Draw a graph that shows the relative concentration of BTB from the center of the
rosijanka [135]

Answer:

did you get the answer???

Explanation:

I really need help

6 0
3 years ago
13. Find the total number of atoms present in the following molecules. a. 5 H₂O b. Zn Cl₂​
olganol [36]

Answer:

A= 15 atoms B= 3

Explanation:

5 x 2 + 5 x 1

3 + 2 x 1

5 0
3 years ago
What are the merits of Mendeleev's periodic table? ​
german

Answer:

This law states that the physical and chemical properties of the elements are the periodic function of their atomic masses. This means that when the elements are arranged in the order of their increasing atomic masses, the elements with similar properties recur at regular intervals.

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • What mass of nitrogen gas is required to react completely with 2.79 g of hydrogen gas to produce ammonia?
    15·1 answer
  • Refer to the first three rows of the periodic table, what element has properties most similar to carbon?
    9·1 answer
  • How many elements are in CH4<br> I will give brainlist
    11·2 answers
  • Methane can be decomposed into two simpler substances: hydrogen and carbon. Therefore, methane 1. is a gas. 2. cannot be an elem
    5·1 answer
  • Need this less than 4 minutes!! In which step do we see the chromosomes condense and meet up to form homologous pair?
    13·1 answer
  • Omg posting takes away point WHAT.
    9·1 answer
  • In ionic bonding, atoms__.
    9·1 answer
  • What is the mass in grams of 7.5 mol of C8H18?
    9·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Describe the pattern in melting point please!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!