1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
3 years ago
13

Which will most likely happen if an appropriate enzyme is added to a chemical reaction

Chemistry
1 answer:
Sliva [168]3 years ago
5 0
It could explode

or blow up


hope it helped
You might be interested in
Is condensation an exothermic or endothermic process? Based on Le Cha^telier’s principle, would you predict the vapor pressure o
Irina18 [472]

Explanation:

A process in which water vapor changes into liquid state is known as condensation. As we know that when energy is released in a reaction then it is known as exothermic reaction and when energy is absorbed in a reaction then it is known as endothermic reaction.

As vapors have high energy so, when they change into liquid state then heat energy is released by them. Therefore, condensation is an exothermic reaction.

As per Le Chatelier's principle, any disturbance caused in an equilibrium reaction will tend to shift the equilibrium in a direction away from the disturbance.

So, when there will occur a decrease in temperature then molecules of a gas will come closer to each other. Hence, there will also occur a decrease in vapor pressure of the gas.

7 0
3 years ago
Draw an alkyl bromide with proper stereochemistry that can be used to synthesize the given alkene as the exclusive product via a
enot [183]

Answer:

See explanation below

Explanation:

You forgot to put the picture to do so. In this case, I manage to find one, and I hope is the one you are looking for. If not, then post it again and I'll gladly help you out again.

According to the picture with the answer, we have a cyclohexane with 4 methyl groups there. Two of them are facing towards the molecule with a darker bond. This means that the alkyl bromide, should have a bromine in one of the bonds, and in order to produce an E2 reaction, this bromine should be facing in the opposite direction of the methyl groups which are facing towards. This is because an E2 reaction occurs with the less steric hindrance in the molecule. If the bromine is in the same direction as the methyl group, it will cause a lot more of work to do a reaction, and therefore, an E2 reaction. I will promote instead a E1 or a sustitution product.

Therefore the alkyl bromide should be like the one in the picture 2.

3 0
3 years ago
PLEASE ANSWERRRRRRRRRRRRRRRRRRRRRRR
Usimov [2.4K]
C because it’s just leaning against the wall it’s not moving
8 0
3 years ago
Read 2 more answers
When Kristen was five, she became sick with chickenpox and then recovered. What claim explains why Kristen is unlikely to get ch
VLD [36.1K]

Answer:

the answer is A!

Mark as brainless

5 0
3 years ago
Read 2 more answers
What is the main idea of the kinetic theory of heat?
Goshia [24]
 – liquids, solids or gases – are made up of atoms and molecules that are in constant motion.<span> The theory also states that collisions between atoms and molecules are elastic</span>
5 0
3 years ago
Other questions:
  • Write the rate laws for the following elementary reactions. (a) ch3nc(g) → ch3cn(g)
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Is this correct im so confused.
    6·1 answer
  • Which of the following combinations of information would allow you to calculate concentration in ppmv? Check all that apply. mol
    6·1 answer
  • Find the wavelength of the electromagnetic radiation with a frequency of 3x10^-18Hz (Show Work)
    10·1 answer
  • Plz help me.....im new here
    14·2 answers
  • On the locating the epicenter exploration what city was near the epicenter?
    9·1 answer
  • Would be grateful if someone could show the process for solving this problem.
    12·1 answer
  • Which one is it answer the question
    14·2 answers
  • You have a 1.8 M solution of HCI. You need to make a 0.70 M solution with a volume of 550 mL. How many mL of the stock solution
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!