1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetoff [14.1K]
3 years ago
14

Noin

Chemistry
1 answer:
OLga [1]3 years ago
5 0

Answer:

Gravity is the answer.

You might be interested in
How many atoms are in 0.065 grams of Cadmium?
lilavasa [31]
D.
because that can only be the answer
8 0
3 years ago
Which option is an example of a chemical change?
MA_775_DIABLO [31]
Firework exploding. Thank you :)
6 0
3 years ago
How many moles are present in 360 grams of water.
alexandr402 [8]

Answer:

From point, 1 mole of water = molar mass of water =18g 20 moles of water = 18 g x 20 = 360g (iv) From point, 6.022 x 1023 molecules of water = 1 mole = 18g of water 1.2044 x 1025 molecules of water Therefore, points (ii) and (iv) represent 360 g of water.

4 0
2 years ago
What explanation accounts for the observation that the mass of the products in reaction #1 (open system) were not equal?
Anna007 [38]

Answer:

The law of conservation of mass states that matter can not be created or destroyed in a chemical reaction.

Explanation:

5 0
2 years ago
What type of bonding holds the atoms in an h2o molecule together?
Ivanshal [37]
Covalent bond  two non metals
3 0
3 years ago
Other questions:
  • Which elements would have properties similar to those of boron (B) ? Se , Li , and Be Al , Ga , and In C, N, and O Na , Mg , and
    12·1 answer
  • Which form of bonding holds cesium chloride (CsCl) together?
    7·1 answer
  • CH3CN major species present when dissolved in water
    6·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A solution of Na2CO3 is added dropwise to a solution that contains 1.12×10−2 M Fe2+ and 1.45×10−2 M Cd2+. What concentration of
    10·1 answer
  • What mass is 2.4E25 molecules of NaHCO3?
    5·1 answer
  • 10 POINTS PLZ HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    10·1 answer
  • If dietary iodine levels are deficient you would expect that plasma tsh levels would be ________ and that plasma thyroxine level
    11·1 answer
  • Which of the following accurately pairs the part of an atom to its charge? A. Electron—no charge B. Proton—no charge C. Neutron—
    13·1 answer
  • Use the following to calculate ΔH°latice of MgF₂:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!