1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FromTheMoon [43]
3 years ago
12

Will give brainliest

Chemistry
1 answer:
Irina18 [472]3 years ago
3 0

Answer:

24.8g of fuel

Explanation:

while

C_{water}=4180j/kg*k

m=\frac{2.7*4180*(100-21)}{36*1000}=24.8g

You might be interested in
A 720. cm^3 vessel contains a mixture of Ar and Xe. If the mass of the gas mixture is 2.966 g at 25.0°C and the pressure is 760.
sleet_krkn [62]

Explanation:

The given data is as follows.

      Pressure (P) = 760 torr = 1 atm

      Volume (V) = 720 cm^{3} = 0.720 L

     Temperature (T) = 25^{o}C = (25 + 273) K = 298 K

Using ideal gas equation, we will calculate the number of moles as follows.

                                PV = nRT

   Total atoms present (n) = \frac{PV}{RT}

                                          = 1 \times \frac{0.720 L}{0.0821 \times 298}

                                           = 0.0294 mol

Let us assume that there are x mol of Ar and y mol of Xe.

Hence, total number of moles will be as follows.

               x + y = 0.0294

Also,      40x + 131y = 2.966

             x = 0.0097 mol

              y = (0.0294 - 0.0097)

                = 0.0197 mol

Therefore, mole fraction will be calculated as follows.

Mol fraction of Xe = \frac{y}{(x+y)}

                               = \frac{0.0197}{0.0294}

                              = 0.67

Therefore, the mole fraction of Xe is 0.67.

6 0
3 years ago
Metals are found on the left-hand side of the periodic table. True or False
Tanya [424]

Answer:

true pls mark brainiest

Explanation:

5 0
3 years ago
The following reaction shows the products when sulfuric acid and aluminum hydroxide react.
scoray [572]

Leftover: approximately 11.73 g of sulfuric acid.

<h3>Explanation</h3>

Which reactant is <em>in excess</em>?

The theoretical yield of water from Al(OH)₃ is lower than that from H₂SO₄. As a  result,

  • Al(OH)₃ is the limiting reactant.
  • H₂SO₄ is in excess.

How many <em>moles</em> of H₂SO₄ is consumed?

Balanced equation:

2 Al(OH)₃ + 3 H₂SO₄ → Al₂(SO₄)₃ + 6 H₂O

Each mole of Al(OH)₃ corresponds to 3/2 moles of H₂SO4. The formula mass of Al(OH)₃ is 78.003 g/mol. There are 15 / 78.003 = 0.19230 moles of Al(OH)₃ in the five grams of Al(OH)₃ available. Al(OH)₃ is in excess, meaning that all 0.19230 moles will be consumed. Accordingly, 0.19230 × 3/2 = 0.28845 moles of H₂SO₄ will be consumed.

How many <em>grams</em> of H₂SO₄ is consumed?

The molar mass of H₂SO₄ is 98.076 g.mol. The mass of 0.28845 moles of H₂SO₄ is 0.28845 × 98.076 = 28.289 g.

How many <em>grams</em> of H₂SO₄ is in excess?

40 grams of sulfuric acid H₂SO₄ is available. 28.289 grams is consumed. The remaining 40 - 28.289 = 11.711 g is in excess. That's closest to the first option: 11.73 g of sulfuric acid.

6 0
3 years ago
Which one would be expected to happen? If one of the buffers that contribute to pH stability in human blood is carbonic acid (H2
tino4ka555 [31]

Answer:

Option (D) is definitely the answer.

Explanation:

Before going further, it is important to know what buffers and pH represent, which are keywords to answering this question.

Buffers is a special solution that can withstand or resist changes due to pH levels which may be as a result of an introduction of acidic or basic components into the blood. In other words, they maintain the stability of pH level in the human blood.

pH blood levels on the other hand, can be grouped into three: acidity, neutrality and alkalinity. Using a pH scale, one can determine its current level. In the human blood the pH level is near neutral and needs to be on a level near 7.4 in order to avoid a high rise or a drastic fall even if acidic or basic components come in or departs the blood stream.

Therefore, if one of the buffers that contributes to pH stability in human blood is carbonic acid, which is as a result of a combination of carbon dioxide and water in the blood stream. On getting to the lungs it is converted to water and subsequently released as waste. Maintaining this stability will definitely be to decrease the concentration of carbonic acid and increase that of water instead.  

5 0
3 years ago
Wood is mainly cellulose, a polymer produced by plants. One use of wood is as a fuel in campfires, fireplaces, and wood furnaces
Alja [10]

Answer:

C6 H10 O5+ 6O2-----> 6CO2+5H2O+heat

Explanation:

There are 6 carbon atoms in reactants to balance you put coefficient 6.

This makes the oxygen in CO2 12 so to balance put 6 in oxygen in reactants.

There are 10 hydrogen atoms in reactants to balance you put 5 in front of H2O in products.

If u recheck: 6 C atoms in reactants, 6 C atoms in products.

10 H atoms in reactants, 10 H atoms in products.

17 O atoms in reactants, 17 O atoms in products.

6 0
2 years ago
Other questions:
  • Write a balanced half-reaction for the reduction of gaseous nitrogen (N2) to aqueous hydrazine (N2H4) in basic aqueous solution.
    9·1 answer
  • Please answer each:) &lt;3
    12·1 answer
  • What is the difference between displacement and double displacement reactions?
    5·1 answer
  • Sophie sees a truck loaded with animals while traveling from Texas to Louisiana. The animals were cramped unhygienic cages. Whic
    15·2 answers
  • In determining nuclear binding energy, what is Einstein's equation used to do?
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • calculate the molarity of a solution that contains 2 moles of NaOH dissolve in 0.5 liter of the solution
    6·1 answer
  • The answer is what I need to know thank you
    11·1 answer
  • A mixture of 10 cm3 of methane and 10 cm3 of ethane was sparked with an excess of oxygen. After cooling to room temperature, thr
    11·1 answer
  • A gas has a volume of 62.65L at O degrees Celsius and 1 atm. At what temperature in Celsius would the volume of the gas be 78.31
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!