1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
3 years ago
15

Calculate the density of a substance for which 4.78 x 106 L of the substance has a mass of 1.50 x 107 kg. Express your answer us

ing the correct number of significant figures, and do not enter your answer using scientific notation.
Chemistry
1 answer:
valentinak56 [21]3 years ago
4 0
7.89 is the correct answer I believe
You might be interested in
If D+2 would react with E!, what do you predict to be the formula?
kherson [118]

Answer:

I think the answers D. Hope this helps you.

Explanation:

6 0
3 years ago
A diesel truck produces 47.5kJ of useful output energy from 125kJ of diesel fuel.what is the truck efficiency?.show the solution
Alex Ar [27]
You have to do a report :
\frac{E_f}{E_i} =  \frac{47,5}{125} = 0,38

So the truck efficiency is 38%.
7 0
3 years ago
Select the number that are signicantbin the number 1500 ?
Andrew [12]
1 and 5 are definitely significant. The zeros might not be significant .
8 0
3 years ago
How does the amount of carbon dioxide affect the rate of photosynthesis?
swat32

Answer:

An increase in the carbon dioxide concentration increases the rate at which carbon is incorporated into carbohydrate in the light-independent reaction, and so the rate of photosynthesis generally increases until limited by another factor.

Explanation:

4 0
2 years ago
Read 2 more answers
How do you convert between the mass and the number of moles of a substance?
Ksivusya [100]
To convert from grams to moles, you divide the number of grams by the molar mass To convert  from moles to grams, you multiply by the molar mass. You must first calculate the molar mass of the substance
6 0
3 years ago
Other questions:
  • A bus traveled south west for 422 kilometers. The entire trip took 3 hours. Calculate the velocity.
    8·1 answer
  • Select all that apply.
    10·2 answers
  • Is Consideringual clay different than<br> sedimentary?
    14·1 answer
  • 1 Which best defines concentration?A ratio that describes the amount of solute divided by the amount of solvent or solutionB rat
    11·1 answer
  • Write the chemical equation for the equilibrium that corresponds to Ka. Write the chemical equation for the equilibrium that cor
    11·1 answer
  • Water acts as a(n) _____. solvent solute organic substance ionic compound
    10·2 answers
  • An atom contains 16 protons, 18 neutrons, and 16 electrons what is its mass number?
    10·1 answer
  • When cobalt(II) chloride is added to pure water, the Co2+ ions are either hydrated to give a pink color, or combined with chlori
    15·1 answer
  • 4. After reaching the final titration endpoint the solution will be cloudy white. As time goes on the solution will turn back to
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!