1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hatshy [7]
2 years ago
6

What energy is stored

Chemistry
1 answer:
denis-greek [22]2 years ago
3 0

Answer: potential energy is stored

Explanation:

You might be interested in
Please help!!! What is electrolysis?
Evgen [1.6K]

Explanation:

plzz tell me the ans even i also want to know plzzzz someone say ans

5 0
2 years ago
Read 2 more answers
An organic compound was extracted into dichloromethane and then the aqueous layer is shaken with saturated sodium chloride solut
Ilya [14]

Answer: option A. to decrease the solubility of the organic product in water

Explanation: sodium chloride solution act as a drying agent to remove water from an organic compound that is in solution. The salt water works to pull the water from the organic layer to the water layer,therby decreasing

6 0
3 years ago
Write the word and balanced chemical equations for the reaction between:
kupik [55]

Answer:

Alumminum hydroxide reacts with sulfuric acid as follows: 2Al(OH)3+H2SO4-->Al2(SO4)+6H2O.

Explanation:

plz mark as brainlist

7 0
2 years ago
A boy walking in the street potential or kenetic energy?​
qwelly [4]
Kinetic

because the boy is walking in the street soo it has force to use
7 0
3 years ago
Read 2 more answers
If you have 16 g of manganese (II) nitrate tetrahydrate, how much water is required to prepare 0.16 M solution from this amount
nirvana33 [79]

<u>Answer:</u> The volume of water required is 398 mL

<u>Explanation:</u>

To calculate the molarity of solution, we use the equation:

\text{Molarity of the solution}=\frac{\text{Mass of solute}\times 1000}{\text{Molar mass of solute}\times \text{Volume of solution (in mL)}}

We are given:

Mass of solute (manganese (II) nitrate tetrahydrate) = 16 g

Molar mass of manganese (II) nitrate tetrahydrate = 251 g/mol

Molarity of solution = 0.16 M

Putting values in above equation, we get:

0.16M=\frac{16g\times 1000}{251g/mol\times \text{Volume of solution}}\\\\\text{Volume of solution}=398mL

Hence, the volume of water required is 398 mL

7 0
3 years ago
Other questions:
  • You plan to separate a polar and a non-polar compound using normal phase column chromatography technique. Methylene chloride (CH
    14·1 answer
  • The repeating pattern of a mineral’s particles forms a solid called a(n)
    14·2 answers
  • What is newtons 3rd law​
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The following are bronsted- lowery acids. Determine what will form when each donates a proton. HI, H2O, NH4+, HNO3
    8·1 answer
  • What country was overrun by the Japanese
    9·2 answers
  • Anyone who could help me would be great!!! Plss!!!
    12·1 answer
  • As part of an investigation, students combined substances in a beaker to observe
    8·1 answer
  • Based on the information below, both Polaris and Sirius are much hotter than the Sun. However, on Earth, we feel the heat from t
    9·2 answers
  • In a person's body, sulfur oxides combine with water vapor in the BLANK to form sulfuric acid.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!