All categories

2 years ago

Tenisha solved the equation below by graphing a system of equations. help!!!!!

Chemistry

1 answer:

Kruka [31]2 years ago

4 0

Answer:

(1.0, 1.4)

Explanation:

Graph the two equations $\log_3 5x$ and $\log_5 (2x+8)$ . The point of intersection is the solution to the system of equations.

Graph on Desmos:

$\log_3 5x\implies \text{Red},\\\log_5 (2x+8)\implies \text{Blue}$

You might be interested in

What changes in trade did Europeans hope to bring about by finding sea routes to Asian markets?

Dovator [93]

Answer:

controlled by the Arabs, who brought frankincense and myrrh by camel caravan from South Arabia.

3 0

3 years ago

Which of the following best describes earth tectonic plates ?

meriva

Answer:

B They move because of the convection currents in the mantle.

6 0

2 years ago

Read 2 more answers

The balanced equation for combustion in an acetylene torch is shown below: 2C2H2 + 5O2 → 4CO2 + 2H2O The acetylene tank contains

andriy [413]

Answer: 67.2 moles

Explanation: $2C_2H5+5O_2\rightarrow 4CO_2+2H_2O$

According to the given balanced equation, 2 moles of acetylene $C_2H_2$ combine with 5 moles of oxygen $O_2$ to produce 4 moles of carbon dioxide $CO_2$ .

Thus if 2 moles of acetylene $C_2H_2$ combine with = 5 moles of oxygen $O_2$

35 moles of acetylene $C_2H_2$ combine with= $\frac{5}{2}\times {35}=87.5$ moles of oxygen $O_2$

But as only 84 moles of oxygen are available, acetylene is not a limiting reagent.

5 moles of oxygen $O_2$ reacts with = 2 moles of acetylene $C_2H_2$

84 moles of oxygen $O_2$ reacts with= $\frac{2}{5}\times {84}=33.6$ moles of acetylene $C_2H_2$

Thus Oxygen is the limiting reagent as it limits the formation of products. Acetylene is excess reagent as it is present in excess.

2 moles of acetylene $C_2H_2$ produce= 4 moles of carbon dioxide $CO_2$ .

33.6 moles of acetylene $C_2H_2$ produce= $\frac{4}{2}\times {33.6}=67.2$ moles of of carbon dioxide $CO_2$ .

8 0

3 years ago

Read 2 more answers

A solid keeps its shape due to which of the following factors? (3 points)

algol [13]

Answer: Attractive forces between particels

Explanation:

8 0

2 years ago

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago