1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
3 years ago
13

Which of these provides the most creative explanation for how rocks are made at present?

Chemistry
1 answer:
xxTIMURxx [149]3 years ago
7 0

Answer:

Principle of Original Horizontality

You might be interested in
PLS HELPP DUE TODAY NEED DONE
Zarrin [17]

Answer:

Explanation:

Each coil increases it by a multiple of 100.

=> 50 | 3 | <u><em>15,000</em></u>

=> 100 | 3 | <u><em>30,000</em></u>

=> 150 | 3 | <u><em>45,000</em></u>

3 0
2 years ago
Read 2 more answers
Which of the following are testable?
jeyben [28]

you forgot the well answers

3 0
2 years ago
Read 2 more answers
How does wavelength differ in high and low frequency waves?
Taya2010 [7]
Waves with higher frequencies have shorter wavelengths, and lower frequencies have longer wavelengths
4 0
3 years ago
Read 2 more answers
10. When a piece of steel wool is burned it gains mass. Which explanation is consistent with the law of conservation of mass?
frez [133]

Answer:

Oh come on. Look at all - then look at A.

Explanation:

4 0
3 years ago
Use the limiting reagent to determine how many grams of Cu(OH)2 should precipitate out in the reaction - CuSo4(aq) + 2NaOH(aq) -
Elis [28]
I think there is a lack of information in the given problem above such as the grams of copper sulfate and sodium hydroxide that was used in the experiment. Kindly resubmit the question with the complete details so that we can help you. Thank you.

7 0
3 years ago
Read 2 more answers
Other questions:
  • When balancing a chemical equation, the number of h atoms in 2 ch4 is eight?
    13·1 answer
  • What is another name for a beta minus (β–) particle?
    15·1 answer
  • For the following reaction, it is found that doubling the amount of A causes the reaction rate to quadruple. Doubling the amount
    15·1 answer
  • The first step in industrial nitric acid production is the catalyzed oxidation of ammonia. Without a catalyst, a different react
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • This states tha
    10·2 answers
  • HELP PLEASE. 50 points!
    10·2 answers
  • Salt dissolving in water is a physical change. (2 points) True False
    5·1 answer
  • HCl reacts with Barium Hydroxide to produce barium chloride and water. how many ml of a 3.00 M hydrochloric acid solution would
    10·1 answer
  • Put the elements in order from easiest to hardest to remove an electron. Ba,Be,Ca,Sr.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!