Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
0.189 g.
Explanation:
- This problem is an application on <em>Henry's law.</em>
- Henry's law states that the solubility of a gas in a liquid is directly proportional to its partial pressure of the gas above the liquid.
- Solubility of the gas ∝ partial pressure
- If we have different solubility at different pressures, we can express Henry's law as:
<em>S₁/P₁ = S₂/P₂,</em>
S₁ = 0.0106/0.792 = 0.0134 g/L and P₁ = 0.321 atm
S₂ = ??? g/L and P₂ = 5.73 atm
- So, The solubility of the gas at 5.73 atm (S₂) = S₁.P₂/P₁ = (0.0134 g/L x 5.73 atm) / (0.321 atm) = 0.239 g/L.
<em>The quantity in (g) = S₂ x V = (0.239 g/L)(0.792 L) = 0.189 g.</em>
<em></em>
Answer:
1.2,dibromoethane is the sha'awa .
Answer:The visible light contains 7 colours : Violet, indigo, Blue, Green, Yellow, Orange and Red.
White colour is formed by the interference of all 7 colours, thus white light has the combination of all frequencies of visible light.
Explanation:
