1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
2 years ago
5

The simplest method to convert an alcohol to an alkyl halide is by reacting the alcohol with concentrated HCl, HBr, or HI. Compl

ete the mechanism and draw the intermediates and final products for the reaction of 1,3-dimethylcyclohexanol with concentrated HCl. Draw all missing reactants and/or products in the appropriate boxes by placing atoms on the grid and connecting them with bonds, including charges where needed. Indicate the mechanism by drawing the electron-flow arrows on the molecules. Arrows should start on an atom or a bond and should end on an atom, bond, or where a new bond should be created.
Chemistry
1 answer:
rusak2 [61]2 years ago
3 0

Answer:

B ska Uffculme u to quell torso

You might be interested in
Which of the four models represents a solid
ICE Princess25 [194]

Answer:

is there an image

Explanation:

6 0
2 years ago
21. Solve the simultaneous equations graphically taking the values of
tigry1 [53]

Answer:

take the l my gang tfdfhngtyhggggggfggg

3 0
3 years ago
Why do atoms form blonds​
lakkis [162]

Answer:

Atoms form chemical bonds to make their outer electron shells more stable. ... An ionic bond, where one atom essentially donates an electron to another, forms when one atom becomes stable by losing its outer electrons and the other atoms become stable (usually by filling its valence shell) by gaining the electrons.

Explanation:

7 0
3 years ago
Cl2 + 2OH− → Cl− + ClO− + H2O
Nataly_w [17]
Cl2(g) -------> Cl-(aq) + ClO-(aq) 

2e- + Cl2(g) -------> 2Cl-(aq) [reduction] 

4OH-(aq) + Cl2(g) -----------> 2ClO-(aq) + 2H2O(l) + 2e- [oxidation] 
______________________________________... 
2OH-(aq) + Cl2(g) --------> Cl-(aq) + ClO-(aq) + H2O(l)
4 0
3 years ago
Iron reacts with cl2 according to the equation 2 fe(s) + 3 cl2(g) ? 2 fecl3(s). how many moles of cl2 is needed to react with 4.
IceJOKER [234]
2Fe + 3Cl₂ ---> 2FeCl₃

4.4mol of Fe, you have a 2:3 ratio of Fe to Cl₂ so divide 4.4/2 = 2.2 and multiply by three 2.2 x 3 = 6.6mol of Cl₂

hope that helps :)
8 0
3 years ago
Read 2 more answers
Other questions:
  • Compare and contrast mutualism and commnsalism. For both relationships, explain who does or does not benefit and who is or is no
    5·1 answer
  • What kind of intermolecular forces act between an oxygen molecule and a neon atom?
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Consider the bonding properties of the three compounds
    11·1 answer
  • Which of the following describes the Bohr atomic model?
    6·2 answers
  • An element with a high ionization energy would most likely be what type of element?
    14·1 answer
  • Which is generally more soluble in water ammonium chloride or potassium chloride explain
    11·1 answer
  • Sobre ações relacionadas ao aquecimento global, assinale somente as alternativas corretas:
    8·1 answer
  • Identify the Lewis acid in this balanced equation:
    12·2 answers
  • What pressure (in atm) is required to contain 0.034 moles of oxygen gas in a 5.1 L container at a temperature of 25.00C
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!