1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
2 years ago
8

What does each row (across) have in common?

Chemistry
1 answer:
Nastasia [14]2 years ago
3 0
Row or periods have in common is the valence electron count. The valence electron count goes up as you move across the periodic table. Also atomic size gets smaller as you move from left to right
You might be interested in
A method of farming that disturbs the soil and its plant cover as the responsible is called
tankabanditka [31]
Conservation plowing.
3 0
3 years ago
Read 2 more answers
Nitrogen is a group 15 element. What does being In this group imply about the structure of the nitrogen atom?
sveticcg [70]

Answer:

Nitrogen has 5 valence electrons

Explanation:

nitrogen has it's attoms form triple bonds which are very hard to break

so non-reactive

4 0
3 years ago
Read 2 more answers
Who wants to be marked as brainlyest
Serjik [45]

Answer:

Ummm...?

Explanation:

5 0
3 years ago
Why do you think plant cells need a cell wall as well as a cell membrane?
Sergio039 [100]

Answer:

to protect it from harm

Explanation:

3 0
3 years ago
The relationship between an object's mass (m), its acceleration (a), and the applied force (F) is described in which of Newton's
Kay [80]

Answer: so the answer is A

Explanation: The relationship between an object's mass (m), its acceleration (a), and the applied force (f) is F=ma. ... This law requires that the direction of the acceleration vector is in the same direction as the force vectors.

5 0
3 years ago
Other questions:
  • A stock bottle of an acid reads: 56% by mass and 1.25 specific gravity. If the molar mass of the acid is 70g, find the mole per
    5·1 answer
  • Does any of these combinations have a change
    9·1 answer
  • A solution of 20.0 g of which hydrated salt dissolved in 200 g H2O will have the lowest freezing point?(A) CuSO4•5H2O(M=250)(B)
    8·1 answer
  • Which of the following is the SI unit used to measure temperature? a. kilogram b. liter c. meter d. Kelvin Please select the bes
    13·2 answers
  • Is hot chocolate a pure substance or a mixture? Explain.
    15·1 answer
  • As the speed of the particles decreases, -
    9·1 answer
  • K₂SO₄(aq) + SrI₂(aq) → 2KI(aq)+ SrSO₄(s) net ionic equation
    12·1 answer
  • If a person swallows acetone what are the procedures that should be followed
    9·2 answers
  • Butane gas reacts with oxygen gas to give carbon dioxide gas and water vapor (gas). If you mix butane and oxygen in the correct
    6·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!