1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
2 years ago
15

As of January 2009, the USA has produced 60,000 metric tons of nuclear waste in 60 yesrs of operating 104 nuclear power plants.

Chemistry
2 answers:
goblinko [34]2 years ago
5 0

Answer:  a. 0.8 tons p. month.

Explanation:

Given: Total nuclear waste = 60,000 metric tons

Time take = 60 years = 12 x 60 months   [ 1 year = 12 months]

=  720 months

Total nuclear power plants = 104

Now , Average  waste produced by each plant = \dfrac{\text{Total waste}}{\text{Time x Number of plants}}

=\dfrac{60000}{720\times104}\approx0.8\text{ tons per month.}

Hence, 0.8 tons p. month is produced by each plant.

So, option a. is correct.

Ipatiy [6.2K]2 years ago
3 0

Answer:

A on edge 2021

Explanation:

You might be interested in
Draw and label the parts of a helium atom. Include the mass and charge of each subatomic particle.
mihalych1998 [28]

Explanation:

Helium is the second element on the periodic table.

  Information about helium:

  • it belongs to group O on the periodic table
  • it is has an atomic number of 2
  • Helium exists naturally as gas and it is nonreactive.

  To write an atom we use this format:

                                     ₙᵇGˣ

   G is the symbol of the atom

   n is the atomic number  

   b is the mass number

    x is the charge on the atom

Using the periodic table as guide

    Symbol of helium is He

     Atomic number of helium is 2

     mass number of helium is 4

     charge on helium atom is 0

                              ⁴₂He

Every atom contains protons, neutrons and electrons;

   Electrons are negatively charged. For a neutral atom, the number of electrons is the same as that of protons.

   Protons are positively charge particles in an atom. The atomic number is the number of protons in an atom.

   neutrons do not have charges.

 

   Helium has:

        Number of protons = 2

        Number of electrons = 2

        Number of neutrons = 2

Mass of each subatomic particle:

      1 electron = 9.11 x 10⁻³¹kg

      2 electrons = 1.82 x 10⁻³⁰kg  

     Protons and neutrons have the same mass:

           1 proton = 1.67 x 10⁻²⁷kg

           2 protons = 3.34 x 10⁻²⁷kg

           2 neutrons = 3.34 x 10⁻²⁷kg

Learn more:

helium brainly.com/question/2439349

#learnwithBrainly

4 0
3 years ago
Gas is heated from 480. K to 750. K and the pressure is kept constant, what final volume would result if the original volume was
attashe74 [19]
Charles law gives the relationship between volume and temperature of gas.
It states that at constant pressure volume is directly proportional to temperature
Therefore
V/ T = k
Where V - volume T - temperature in kelvin and k - constant
V1/T1 = V2/T2
Parameters for the first instance are on the left side and parameters for the second instance are on the right side of the equation
Substituting the values in the equation
267 L/ 480 K = V / 750 K
V = 417 L
Final volume is 417 L
8 0
3 years ago
A neutron has a mass A. that is less than the mass of an electron. B. that is about equal to the mass of an electron. C. that is
soldi70 [24.7K]

Answer:

Option C:- that is equal to mass of an proton.

Explanation:

Protons and neutrons have approximately the same mass, about 1.67 × 10-24 grams, which scientists define as one atomic mass unit (amu) or one Dalton. While electron has mass of 9.31 ×10⁻¹⁹.

6 0
2 years ago
In the name, iron(III) oxide, the (III) represents
Veronika [31]
<h2>In the name, iron(III) oxide, the (III) represents: D) the electrical charge of iron</h2><h2>Explanation:</h2>

To attain stability the chemical bond is formed .

Chemical bond

It is a kind of linkage that binds one atom with the other .

The atoms do so in order to attain stable noble gas configuration .

To form chemical bond they either:

Loose electrons : when atoms loose electrons they acquire positive charge which is equal to the number of electrons lost .

Gain electrons: After gaining electrons they acquire negative charge which is equal to the number of electrons gained by an atom.

share electrons : With sharing no charges are develop .

<em>In the above asked question when iron combines with oxygen it forms iron oxide : where iron looses 3 electrons and oxygen gains 2 electrons .That is the reason ,III here represents  the electrical charge of iron</em>

7 0
3 years ago
The average kinetic energy of the particles in an object is directly proportional to its
Galina-37 [17]
C. Temperature the average <span> kinetic energy of the particles in an object is directly proportional to its temperature </span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • A sample of water and alcohol are mixed. What method should be used to separate them? -Screening -Filtering -Fractional distilla
    12·2 answers
  • The products of a combustion reaction do NOT include ____. (1 point) water carbon dioxide carbon monoxide hydrogen The products
    10·2 answers
  • Climates are classified acording to which two major factors
    12·1 answer
  • A soccer player twists her ankle on the field. The atheltic trainer applies an ice bag with 260 g of ice inside. How much heat,
    12·1 answer
  • The balanced equation for the combustion of Hydrogen is:
    7·1 answer
  • The chemical equation shows how ammonia reacts with sulfuric acid to produce ammonium sulfate. 2NH3(aq) + H2SO4(aq) (NH4)2SO4(aq
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • hi guys im giving away brainliest answer away for a good cause who ever gives me the best rating for my profile picture gets bra
    15·1 answer
  • Itssssssssss scienceeeeeee
    10·1 answer
  • Geologically, the Himalayan mountain range is one of the youngest mountain ranges on Earth. It has nine of the ten highest peaks
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!