Answer:
8.7 L
Explanation:
T2(V1/T1) = V2
417.15 K(6.2 L/296.45 K) = 8.7 L
Remember to almost always change celcius to kelvin. Also, this is part of Charle's Law (temp and volume are proportional, so if temp increaces so must the volume or vice versa). Lastly, Charle's Law has the formula of V1/T1 = V2/T2. I just rearranged it to go along with your problem. Hence, the T2(V1/T1) = V2
Hi Lara
The answer is : C
Is equal to
I hope that's help!
Answer:
1. Ionic bond
2. High melting point and high boiling point for ionic bonds while covalent bonds have low melting and boiling point.
3. The similarity is that ionic and covalent bonding lead to the creation of stable molecules.
4. 4Fe + 3O2 → 2Fe2O3
5. It uses the process of fission.
6. Fission involves the splitting of radioactive elements into smaller particles/compounds while Fusion involves combining of two or more atomic nuclei to form one or more different atomic nuclei and subatomic particles.
7. Nuclear power plants produce little to no greenhouse gas.
Nuclear power plants produce a large amount of energy for a small mass of fuel.
Nuclear is less expensive.
Newton’s third law, because a person(a) is acting upon the ball(b) by dribbling the ball on the floor
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
