1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
3 years ago
5

Which place in the world has the highest average annual precipitation?

Chemistry
2 answers:
alekssr [168]3 years ago
6 0

Answer: Colombia

Explanation:

Delvig [45]3 years ago
5 0
Mawsynram India :)))
You might be interested in
Are inic bonds formed when electrons are equally or unequally shared
lisabon 2012 [21]

The electrons are unequally shared. The electronegative element receives the electrons from the electropositive one.

8 0
3 years ago
What are the three types of protist and how are they similar and how are they different (this is science but there is no tab for
allochka39001 [22]

Answer:

They are eukaryotic, which means they have a nucleus. Most have mitochondria

3 0
2 years ago
g n the Ideal Gas Law lab, how is the temperature of the hydrogen gas determined? Select one: The pressure of the gas is determi
Charra [1.4K]

Answer:

The volume of the gas is determined, which will allow you to calculate the temperature.

Explanation:

According to Charles law; the volume of a given mass of an ideal gas is directly proportional to its temperature at constant pressure.

This implies that, when the volume of an ideal gas is measured at constant pressure, the temperature of the ideal gas can be calculated from it according to Charles law.

Hence in the Ideal Gas Law lab, the temperature of an ideal gas is measured by determining the volume of the ideal gas.

4 0
2 years ago
Need help on question 3 plz<br> URGENT HELP PLZ
Law Incorporation [45]
Alloys are the homogeneous mixture of metals and non metals.... they are used in making cars and jewellery to make them more featurable,,, means that they would possess high regidity to the destruction .... both features of metal and nonmetal
5 0
3 years ago
How many moles of LiOH are required to make 4.2 liters of a 0.98 M
ASHA 777 [7]

Answer:

4.12 mol  

Explanation:

Given data:

Moles of LiOH  required = ?

Volume of solution = 4.2 L

Molarity of solution = 0.98 M

Solution:

Molarity is used to describe the concentration of solution. It tells how many moles are dissolve in per litter of solution.

Formula:

Molarity = number of moles of solute / L of solution

we will calculate the moles from above given formula.

0.98 M = number of moles / 4.2 L

0.98 M × 4.2 L = number of moles

Number of moles = 0.98 M × 4.2 L

Number of moles = 4.12 mol     (M = mol/L)

7 0
3 years ago
Other questions:
  • PLEASEEE HELPPPP....PLEASEEEE
    13·2 answers
  • A _ is a whole number that appears before formula in an equation
    15·1 answer
  • Module 2 dba for chemistry questions? flvs
    6·1 answer
  • Question 7
    13·2 answers
  • Answer EIGHT questions.
    11·1 answer
  • What is the name of this moleculee?
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Find 4 items around you OR online if you like. They can be something as simple as table salt or a plastic fork, or as complex as
    13·1 answer
  • Argue whether this chemical reaction supports or does not support the Law of Conservation of Matter.
    10·1 answer
  • Bonding Story Mini Project
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!