1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tiny-mole [99]
3 years ago
12

A solution of sodium iodide is added to a solution of potassium nitrate to make a potassium iodide precipitate and a sodium nitr

ate solution?
Key Words
KNO3
NaNO3
KI
NaI
Chemistry
1 answer:
stich3 [128]3 years ago
4 0

Answer:

NaNO3

Explanation:

Sorry If its incorrect

You might be interested in
Help me plzz I need help ​
Sladkaya [172]

The is no picture???????

3 0
3 years ago
A 0.1 gram sample of an unknown liquid is vaporized completely at 70 degrees C to fill a 750mL flask. The pressure is 0.05951atm
Deffense [45]

Answer:

The molar mass of the liquid 62.89 g/mol

Explanation:

Step 1: Data given

Mass of the sample = 0.1 grams

Temperature = 70°C

Volume = 750 mL

Pressure = 0.05951 atm

Step 2: Calculate the number of moles

p*V = n*R*T

n = (p*V)/(R*T)

⇒ with n = the number of moles gas = TO BE DETERMINED

⇒ with p = The pressure = 0.05951 atm

⇒ with V = The volume of the flask = 750 mL = 0.750 L

⇒ with R = The gasconstant = 0.08206 L*atm/K*mol

⇒with T = the temperature = 70 °C = 343 Kelvin

n = (0.05951 *0.750)/(0.08206*343)

n = 0.00159 moles

Step 3: Calculate molar mass

Molar mass = mass / moles

Molar mass =0.1 gram /  0.00159 moles

Molar mass = 62.89 g/mol

The molar mass of the liquid 62.89 g/mol

6 0
3 years ago
What is the most abundant gas in Earth's present day atmosphere?
Anna007 [38]
Nitrogen. air consists 78% of nitrogen gas
4 0
3 years ago
Read 2 more answers
A sample of a compound made entirely from copper and oxygen was found to have a total mass of 0.143 g the mass of copper in the
tensa zangetsu [6.8K]

Mass of Oxygen: 0.0159 grams

Moles of Oxygen: 9.94x10^-4

To find the mass of oxygen, subtract the mass of copper from the total mass.

0.143-0.1271=0.0159

There are 0.0159 grams of Oxygen.

To find how many moles there are, divide the given amount of oxygen by the molar mass (atomic mass) of oxygen because that mass is the same as one mole of oxygen.

Molar mass of Oxygen: 16.00

0.0159/16.00=9.94*10^{-4}

There are 9.94*10^-4 moles of Oxygen.

6 0
1 year ago
HELP FAST 100 PTSCalculate the amount of heat needed to convert 100.0 g of liquid water at 25 °C to water at 100 °C.
Alex Ar [27]

Answer:

31,380 Joules

Explanation:

Given Data:

Mass = m = 100 g

Temperature 1 = = 25 °C

Temperature 2 = = 100 °C

Specific Heat Constant = c = 4.184

Change in Temp. = ΔT = 100 - 25 = 75 °C

Required:

Heat = Q = ?

Formula:

Q = mcΔT

Solution:

Q = (100)(4.184)(75)

Q = 31, 380 Joules

Hope this helped!

~AH1807

4 0
3 years ago
Read 2 more answers
Other questions:
  • Question 20 (Essay Worth 8 points)
    13·2 answers
  • how much heat, in terms in q, would it take to produce the change in temperature indicated in the picture? what is your reasonin
    8·1 answer
  • The ________ is what needs to be overcome in a reaction so that it can proceed to the products.
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What dose iff mean when used in a biconditional statement
    6·1 answer
  • Compared to a solid, the molecular bonds of a liquid are.
    12·2 answers
  • A quart is how many pounds
    6·2 answers
  • What is the name and symbol of the element in the second row and fourteenth column of the periodic
    14·1 answer
  • Extra points &amp; brainlest to anyone that can help me with both answers
    9·1 answer
  • 1. What is the apparatus used to measure production in plants ?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!