1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
14

Which element has the lowest first ionization energy? Be Sr OCa Mg

Chemistry
1 answer:
Dmitrij [34]3 years ago
5 0
Answer
I think Sr
Hope this help!
You might be interested in
Question 4 (1 point)
Rainbow [258]

а о

Explanation:

 The given cation:

           (Rf₂Al₂F₃)³⁺

The oxidation number gives the extent to which a specie is oxidized in a reaction.

This number is assigned based on some rules:

  • Elements in combined state whose atoms combines with themselves have an oxidation number of zero.
  • The charge carried on simple ions gives their oxidation number.
  • Algebraic sum of all the oxidation numbers of atoms in neutral compound is zero. In an ion with more than one kind of atom, the charge on it is the oxidation number.

for the specie given;

Known:

  oxidation number of Al = +3

                                      F = -1

                          charge = +3

    let the oxidation number of Rf = k

        2k + 2(3) + 3(-1) = +3

          2k + 6 - 3 = 3

            2k = 0

              k = 0

The oxidation state of rutherfodium is 0

learn more:

Oxidation state brainly.com/question/10017129

#learnwithBrainly

8 0
3 years ago
Which ionic compound is soluble in water pbbr2, fe (oh)3,ca(no3)2, baso4?
Anton [14]

Ionic compound are those compounds which are made up of ions. The ion which has tendency to loose electrons is said to cation (positive charge) such as metals whereas ion which has tendency to gain electrons is said to anion (negative charge) such as non-metals.

Calcium nitrate is quite soluble in water due to very low lattice enthalpy in comparison to other ionic compound. With lower lattice enthalpy, less energy is required for the dissociation of calcium nitrate and it get dissolves in water than other three compounds. Moreover, hydration energy is higher for calcium nitrate which make its solubility higher in water than other ionic species.

Thus, Ca(NO_{3})_{2} is correct answer.

5 0
3 years ago
Name the following alkyne.<br> Please help me &lt;3
Alexandra [31]

Answer:

D. 7-methyl-3-octyne

Explanation:

1) Identify the parent chain and name it like an alkane.

• The longest chain of carbons, which consists of the functional group (which is the alkyne group in this case: C≡C).

• There are 8 carbons in the longest chain, so it is called an octane.

2) Now, identify the location of the functional group.

• The location number of the functional group should be as low as possible. Thus although we could count from the right, we start counting from the left since the functional group is closer to the left. From the left, the functional group would be at carbon 8 while from the left, it is on carbon 3.

• Replace 'ane' with 'yne' in octane for the alkyne group.

• This would give us 3-octyne.

3) Lastly, add in the name of the branch.

• Here we have one branch, -CH₃. This is read as methyl.

• Identify the location number of the branch by counting the number of carbons in the same direction as when we counted the location number of the functional group. The methyl branch has a location number of 7.

• Adding the name of the branch before the parent chain, we would arrive at 7-methyl-3-octyne as the IUPAC name of the alkyne.

Further Explanation:

A) This option is incorrect as there are only 8 carbons in the parent chain. Although there are 9 carbons in total, the 9th carbon is taken care of in '7-methyl'.

B) Location number of the functional group should be as low as possible, so start counting the number of carbons from the left!

C) Since the functional group is an alkyne, the word 'octane' should be 'octyne' instead.

8 0
3 years ago
When using 100ml or 50ml graduated cylinder to what decimal place can your volume be estimated?<br>​
Olegator [25]

Answer:

I know that the 100-mL graduated cylinders are always read to 1 decimal place.

I think for 50 mL graduated cylinders, it lets you measure volumes up to 50.0 mL to the nearest 0.1 or 0.2 mL, depending on your exact cylinder.

3 0
3 years ago
What are deltaTb and deltaTf for an aqueous solution that is 1.5g nacl in 0.250kg h2o? Given Kb=0.51 C/m and kr=1.86 C/m
bulgar [2K]

Answer:

T_f for given question is 2.79 and T_b is 0.52

\Delta T_b = I \times K_b \times m {i- vant hoff’s constant ; Kb- constant ; m molarity }

M = no. of moles of the solute present in one kg of solution

Let the weight of amount of solute be “w” and its molecular mass be “M”

Let the mass of the solvent in the given question be “x”

\Delta T_b = I \times K_b \times (w/M)/ x

\Delta T_b = I \times K_b \times w/Mx

\Delta T_b = 1 \times 0.51 \times1.5/(0.250 \times 58.44) = 0.052

\Delta T_f = M \times K_f = 1.86 \times 1.5 = 2.79

4 0
3 years ago
Other questions:
  • Suppose you have 0.100 m3 of co2, at pressure of 2.00 atm, and a temperature of 30.0?c. How many grams of co2 do you have? Expre
    6·1 answer
  • Which characteristic of life is demonstrated when eagles use sharp talons to grab fish from the water?
    7·2 answers
  • Which is not an essential component of a voltaic cell?
    11·1 answer
  • _Cuo +H, → _Cu + _H,0
    15·1 answer
  • If 50.0 g of silicon dioxide is heated with an excess of carbon, 27.9 g of silicon carbide is produced. What is the percent yiel
    13·1 answer
  • I have the smallest atomic number of all the
    10·1 answer
  • Can someone help its not hard. What are the cons of using a cup made of plastic?
    5·1 answer
  • How much NaCl would you dissolve and dilute to the 100.00 mL mark in a volumetric flask with DI H2O to prepare a 0.825 M sodium
    10·1 answer
  • Why should you label your plates on the bottom instead on the lid?
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!