1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
2 years ago
11

Compound A has 4 moles of hydrogen, 4 moles of oxygen, and

Chemistry
1 answer:
Sophie [7]2 years ago
3 0

Answer:

H₄SiO₄

Explanation:

From the question given above, the following data were obtained:

Hydrogen (H) = 4 moles

Oxygen (O) = 4 moles

Silicon (Si) = 1 mole

Empirical formula =?

Since the number of mole of each atom of the element present is known, the empirical formula of the compound can be written as follow:

H₄SiO₄

You might be interested in
When a polypeptide is in its native conformation,there are weak interactions between its R groups. However, when it is denatured
Marina86 [1]

Answer:

In the unfolded polypeptide, there are ordered solvation shells of water around the protein

groups. The number of water molecules involved in such ordered shells is reduced when the protein

folds, resulting in higher entropy. Hence, the lower free energy of the native conformation.

Explanation:

4 0
3 years ago
If you burn yourself bt touching a hot stove ,it is an example of heat transfer by
ehidna [41]
Conduction is the act of touching 2 solids where one transfers heat
6 0
3 years ago
Why is a quantitative observation more useful than a non- quantitative one? Which of the following are quantitative?
daser333 [38]
A quantitative observation is not necessarily more useful than a non-quantitative one. However, quantitative observations do allow one to find trends.

(a), the sun rising is a non-quantitative observation.

(b), knowledge of the numerical relationship between the weight on the Moon and on Earth, is a quantitative observation.

(c), watching ice float on water does not involve a measurement; therefore, it must be a qualitative observation.

(d) the fact that we know that the water pump won’t work for depths more than 34 feet makes it quantitative. Again, seeing numbers is a giveaway that it’s a quantitative <span>observation. Quantitative is where you deal with numbers.</span>
7 0
3 years ago
Jack walks outside in the afternoon and noticed the clouds are very dark. He states that it looks like it will rain very soon. H
Kay [80]

Answer:

I think it would be A but it might be B please tell if wrong

7 0
3 years ago
Read 2 more answers
What is the coefficient for the formula 6C6H12O6?
djyliett [7]
<span>Multiply the coefficient in front of the formula times the subscript for each element. This gives 36 carbon atoms, 72 hydrogen atoms, and 36 oxygen atoms.</span>
5 0
3 years ago
Other questions:
  • PLS HELPP!!Which accurately describes one impact of the atmosphere on Earth’s cycles?
    8·2 answers
  • Name the layers of Earth starting at the crust and going in. Describe the composition of each layer.
    6·1 answer
  • An airplane leaves Orlando, FL and travels 540 miles to Washington D.C. The flight takes 90 minutes. What is the speed of the pl
    12·2 answers
  • What type of energy is stored for use at a later time? Bond energy Free energy Kinetic energy Potential energy
    11·2 answers
  • PLEASE HELP 25 POINTS!!!!
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Rate law equation The rate of a chemical reaction depends on the concentrations of the reactants. For the general reaction betwe
    5·1 answer
  • What are solids at room temperature and conduct electricity and heat?
    7·1 answer
  • Is it okay ?<br>off it's difficult to find a pic for a boy ​
    14·2 answers
  • THIS IS SCIENCE If you answer this please make two sides or list which go on each one whether it is Terrestrial or Jovian. I wil
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!