1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mademuasel [1]
3 years ago
11

How do you name AsO3

Chemistry
1 answer:
Elena-2011 [213]3 years ago
4 0

CVOPEDIA-CVOSOFT

Explanation:

ESPERO TE SIRVA

You might be interested in
How many electrons must Aluminum lose or gain to obtain a noble gas<br> electron configuration? *
BaLLatris [955]

Answer:

3 electrons

Explanation:

aluminum : [Ne]3s23p1 [ N e ] 3 s 2 3 p 1 . It loses 3 electrons from 3s and 3p orbitals and attains the noble gas configuration of Neon.

6 0
3 years ago
Read 2 more answers
Study this chemical reaction:
Ray Of Light [21]

Answer:

oxidation:Ti to Ti           Reduction:O2 toO2

Explanation:

<em>oxidation loses electron while Reduction gains electron</em>

3 0
3 years ago
Read 2 more answers
A sample of argon gas at 55°C is under 845 mm Hg pressure. What will the new temperature be if the pressure is raised to 1050 mm
Maurinko [17]

Answer:

The final temperature at 1050 mmHg is 134.57 ^{\circ}C or 407.57 Kelvin.

Explanation:

Initial temperature = T = 55^{\circ}C = 328 K

Initial pressure = P = 845 mmHg

Assuming final  to be temperature to be T' Kelvin

Final Pressure = P' = 1050 mmHg  

The final temperature is obtained by following relation at constant volume

\displaystyle \frac{P}{P'}=\displaystyle \frac{T}{T'} \\ \displaystyle \frac{845 \textrm{ mmHg}}{1050 \textrm{ mmHg}} = \displaystyle \frac{328 \textrm{ K}}{T'} \\T' = 407.57 \textrm{ Kelvin}

The final temperature is 407.57 K

7 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
PLEASE HELP!!
wariber [46]

Answer:

answer is option 2 hope it helps

8 0
3 years ago
Other questions:
  • Sayid recorded the temperatures of four substances in a chart. which conclusion is best supported by the data?
    11·1 answer
  • Why is it important to clean and care for cuts on your skin
    6·1 answer
  • Nitrogen reacts with hydrogen to produce ammonia gas as follows. mc023-1.jpg How many moles of nitrogen would react with excess
    8·2 answers
  • 3. How many grams of<br> CoCl, in 1/2 Liter would be<br> used to make a 1.0 molar<br> solution?
    15·1 answer
  • Which best describes a compound?
    12·1 answer
  • What significant contribution did Lavoisier make to chemistry?
    15·1 answer
  • Name the element of standard mass.
    5·1 answer
  • Ai giúp em giải thích cơ chế điều chế phẩm màu diazo và phản ứng ghép đôi với ạ . em xin cám ơn
    6·1 answer
  • Can someone please help
    15·1 answer
  • May someone help me on this
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!