Answer:
3 electrons
Explanation:
aluminum : [Ne]3s23p1 [ N e ] 3 s 2 3 p 1 . It loses 3 electrons from 3s and 3p orbitals and attains the noble gas configuration of Neon.
Answer:
oxidation:Ti to Ti Reduction:O2 toO2
Explanation:
<em>oxidation loses electron while Reduction gains electron</em>
Answer:
The final temperature at 1050 mmHg is 134.57
or 407.57 Kelvin.
Explanation:
Initial temperature = T = 55
= 328 K
Initial pressure = P = 845 mmHg
Assuming final to be temperature to be T' Kelvin
Final Pressure = P' = 1050 mmHg
The final temperature is obtained by following relation at constant volume

The final temperature is 407.57 K
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
answer is option 2 hope it helps