1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notsponge [240]
2 years ago
14

CH, + , 0, → _CO, + Н,0 Balance chemical equation

Chemistry
1 answer:
Flura [38]2 years ago
6 0

Answer:

2 CH2 + 3 O2 = 2 CO2 + 2 H2O

Explanation:

This is what I think that you meant by the question listed. When balancing a chemical equation, you want to make sure that there are equal amounts of each element on each side.

Originally, the equation's elements looked like this: 1 C on left & 1 C on right; 2 H on left & 2 H on right; 2 O on left and 3 O on right. Because these are not balanced, you need to add coefficients.

When adding coefficients, you need to make sure that all of the elements stay balanced, not just one that you are trying to fix. I know that some equations are really difficult to balance, and when that is the case, there are equation balancing websites that can help out.

However, what always helps me is making a chart and continuing to keep up with the changes I am making. It is a trial and error process.

You might be interested in
Please help me ಥ_ಥ
dexar [7]

Energy is stored in chemical bonds during photosynthesis.

During photosynthesis, the radiant energy from the sun is converted to chemical energy in carbohydrates.

Inorganic materials in the form of carbon dioxide and oxygen combine to form carbohydrates in the presence of radiant energy according to the equation below:

6CO_2 + 6H_2O ---> C_6H_1_2O_6 + 6O_2

The energy is thus, stored in chemical bonds in the carbohydrate and this is what is oxidized during respiration to release the locked energy.

More on photosynthesis can be found here: brainly.com/question/1388366

7 0
2 years ago
Read 2 more answers
EXPLAIN How would you explain the difference between single displacement and
IrinaK [193]
  • The difference between single displacement reaction and double displacement reaction are:

Explanation:

in the chemical reaction an atom in a molecule is replaced by another atom forming the end product .this type of chemical reaction involved only two reactants for example zinc + copper sulphate give us copper sulphate + copper.double displacement reaction is the reaction in which two compounds react together to form two other compounds by mutual exchange of other ions is called double displacement reaction.this type of reaction is involved two or more than two reactants.for example AG and O3 + NaCl give us agcl + nano3

3 0
2 years ago
I need help please WOTH this
barxatty [35]

Answer:

Kenma I'll help you! it's B.

Explanation:

I hope I helped you Kenma

7 0
3 years ago
What happens when sodium and sulfur combine
german

Answer:

It emits hydrogen sulfide...smells like rotten eggs..

ty:)pls let me know whether this is ryt:D

6 0
2 years ago
Read 2 more answers
Hi everyone how is your guys day huh I believe good right
Kisachek [45]
H, my day has been alright, how’s yours?
7 0
2 years ago
Other questions:
  • Where do scientists believe chemical evolution occurred?
    15·2 answers
  • How would the following solid substances be classified? The choices are metallic, ionic, or molecular. C6H12O6
    9·1 answer
  • if a solution measured with the miscalibrated meter (above) gave a reading of 6.50 at 20oC, what should be the true pH (give 2 d
    13·1 answer
  • In order to complete a lab, your teacher needs a 3.0 M solution of sulfuric acid, but only has a 12.0 M stock solution of sulfur
    14·1 answer
  • What is the empirical formula of an oxide of nitrogen containing 63.61% by mass of nitrogen and 36.69% by mass of oxygen?
    14·1 answer
  • PH for the solution which contain CO​
    7·1 answer
  • At a certain fixed temperature, the reaction A(g) + 2 B(g) → AB2(g) is found to be first order in the concentration of A and zer
    7·1 answer
  • Draw the structure of the Tetrapeptide asp-met-lys-tyr
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which type of precipitation is shown in the diagram below? How does this precipitation form?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!