1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
9

A sample of paraffin wax undergoes the following change: C25H52(s) → C25H52(l)

Chemistry
1 answer:
nalin [4]3 years ago
5 0

Answer:

Explanation:

(a) Answer: Intermolecular forces

The reason for this answer is because the substance (paraffin wax) only changed it's state from solid to liquid and didn't undergo a breakage in it's covalent bond within it's carbon chain which would have produced another substance.

(b) Solid substances are generally more dense than there corresponding liquid substances because the more compact particles are (which occurs in solids), the more dense they become. They are thus more dense than liquids because liquids have there particles loosely packed and well spaced making them less dense than there corresponding solids. Hence, the solid paraffin wax was going to become less dense because it's particles moved from being tightly packed (as solids) to being loosely packed (as liquids). Density refers to mass per volume but can also be described as the level of compactness of a substance. Thus, since liquid is not as compact as solid, it can be said to be less dense than solids.

You might be interested in
Which is correct if 15,390,000 is rounded to two significant figures?
BARSIC [14]

Answer:

Explanation:

Remark

This is one of those questions that you need the choices. You can't tell what you should enter. For example, in scientific notation, you would get 1.5*10^7.

Or you could keep it as an integer and round to two places 150,000,000,

I would pick scientific notation if you know how to use it. Otherwise use the interger format.

7 0
2 years ago
Most animals that live in soil live in the _______ layer.
labwork [276]

Answer:

Living organisms present in soil include archaea, bacteria, actinomycetes, fungi, algae, protozoa, and a wide variety of larger soil fauna, including springtails, mites, nematodes, earthworms, ants, insects that spend all or part of their life underground, and larger organisms such as burrowing rodents.

Explanation:

8 0
3 years ago
Read 2 more answers
When 5.00 g of Al2S3 and 2.50 g of H2O are reacted according to the following reaction: Al2S3(s) + 6 H2O(l) → 2 Al(OH)3(s) + 3 H
Debora [2.8K]

Answer:

Y=58.15\%

Explanation:

Hello,

For the given chemical reaction:

Al_2S_3(s) + 6 H_2O(l) \rightarrow 2 Al(OH)_3(s) + 3 H_2S(g)

We first must identify the limiting reactant by computing the reacting moles of Al2S3:

n_{Al_2S_3}=5.00gAl_2S_3*\frac{1molAl_2S_3}{150.158 gAl_2S_3} =0.0333molAl_2S_3

Next, we compute the moles of Al2S3 that are consumed by 2.50 of H2O via the 1:6 mole ratio between them:

n_{Al_2S_3}^{consumed}=2.50gH_2O*\frac{1molH_2O}{18gH_2O}*\frac{1molAl_2S_3}{6molH_2O}=0.0231mol  Al_2S_3

Thus, we notice that there are more available Al2S3 than consumed, for that reason it is in excess and water is the limiting, therefore, we can compute the theoretical yield of Al(OH)3 via the 2:1 molar ratio between it and Al2S3 with the limiting amount:

m_{Al(OH)_3}=0.0231molAl_2S_3*\frac{2molAl(OH)_3}{1molAl_2S_3}*\frac{78gAl(OH)_3}{1molAl(OH)_3} =3.61gAl(OH)_3

Finally, we compute the percent yield with the obtained 2.10 g:

Y=\frac{2.10g}{3.61g} *100\%\\\\Y=58.15\%

Best regards.

7 0
3 years ago
Classify the following as a type of potential energy or kinetic energy (use the letters K or P)
Zanzabum
K, P, K, K, P, K, K, P, K, P. If it is moving, it is kinetic, if it isn't, it's potential. the sugar one is a little tricky using that method though, because we generally consider this in terms of spacial movement, but sugar holds energy which is later released by your body to allow you to move.the chemical bonds have potential energy because they release energy when broken.
5 0
3 years ago
Read 2 more answers
Calculate the amount of heat gained when one 250 gram bottle is heated from 25oC to 30oC. The specific heat of water is 4.18 J/g
Fed [463]

Answer:

5230J

Explanation:

Mass (m) = 250g

Initial temperature (T1) = 25°C

Final temperature (T2) = 30°C

Specific heat capacity (c) = 4.184J/g°C

Heat energy (Q) = ?

Heat energy (Q) = Mc∇T

Q = heat energy

M = mass of the substance

C = specific heat capacity

∇T = change in temperature = T2 - T1

Q = 250 × 4.184 × (30 - 25)

Q = 1046 ×5

Q = 5230J

The heat energy required to raise the temperature of 250g of water from 25°C to 30°C is 5230J

7 0
3 years ago
Read 2 more answers
Other questions:
  • A sample of gas in which [h2s] = 5.25 m is heated to 1400 k in a sealed vessel. after chemical equilibrium has been achieved, wh
    7·1 answer
  • What is the volume of an 2.3 solution with 212 grams of calcium chloride dissolved in it
    14·1 answer
  • Based on the information shown, which statement about the subatomic particle must be correct?
    5·1 answer
  • Which statement best describes the temperature dependence of an addition reaction? Addition reactions are thermodynamically impo
    6·2 answers
  • he combustion of propane (C3H8) is given by the balanced chemical equation C_3H_8+5O_2\longrightarrow3CO_2+4H_2O C 3 H 8 + 5 O 2
    14·1 answer
  • Match the prefixes. 1. 1 hex- 2. 2 eth- 3. 3 prop- 4. 4 hept- 5. 5 non- 6. 6 dec- 7. 7 pent- 8. 8 but- 9. 9 meth- 10. 10 oct-
    10·1 answer
  • Skydivers jump out of planes with only the backpacks on their backs. Of course, these packs contain the parachutes that keep sky
    5·2 answers
  • Which factor affects the amount of gravitational potential orgy at object but
    11·2 answers
  • Which term refers to an element that conducts electricity at high temperatures, but not at low temperatures?
    9·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!