1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
5

Two Places were freshwater is found on earth

Chemistry
2 answers:
irakobra [83]3 years ago
8 0
Fresh water is found in glaciers, lakes, reservoirs, ponds, rivers, streams, wetlands and even groundwater.

You can pick two of these
hichkok12 [17]3 years ago
7 0

Answer:

Explanation:

Over 68 percent of the fresh water on Earth is found in icecaps and glaciers, and just over 30 percent is found in ground water. Only about 0.3 percent of our fresh water is found in the surface water of lakes, rivers, and swamps. Of all the water on Earth, more than 99 percent of Earth's water is unusable by humans and many other living things!

You might be interested in
Read the following passage.
Archy [21]

Answer is: the discovery of sub atomic particles like electrons.

J. J. Thomson discovered the electron in 1897.  

His "plum pudding" model (1904) suggested: the electrons are embedded in the positive charge.  

With this model, he abandoned his earlier hypothesis (the atom was composed of immaterial vortices).  

J.J. Thomson placed two oppositely charged electric plates around the cathode ray. He did experiments using different metals as electrode materials and found that the properties of the cathode ray remained constant no matter what cathode material he used.

Tomson concluded that atoms are divisible and that the corpuscles are their building blocks (atoms are made up of smaller particles).  

7 0
3 years ago
Read 2 more answers
How many atoms are in 22 grams of copper metal?
strojnjashka [21]
Atomic mass Cu = 63.546 a.m.u

63.546 g ---------------- 6.02x10²³ atoms
22 g --------------------- ??

22 x (6.02x10²³ ) / 63.546 => 2.08x10²³ atoms

hope this helps!
6 0
3 years ago
What manmade changes to the environment potentially increase the impact of this hazard?
storchak [24]

Answer:

natural disasters

Explanation:

Drought.

Earthquake.

Flash flood.

Hurricane.

Tornado.

Wild fire.

Winter storm.

these are some examples, hope this helps :)

5 0
3 years ago
Read 2 more answers
What is the concentration of the acid in this titration 1.2 m 2.4 m 1.95 m 0.98 m 1.98 m
tresset_1 [31]

Answer:

1.95

Explanation:

Just did the test and it was correct!

5 0
3 years ago
Read 2 more answers
What is the percent composition of each of the elements in Al(OH) 3 ?
stellarik [79]

Answer:

<em>Answer Below</em>

Explanation:

Percent composition by element

<u>Element </u>       <u>Symbol</u>  <u>Mass Percent</u>

Aluminium <u>Al</u>          34.590%

Hydrogen <u>H</u>          3.877%

Oxygen         <u>O</u>          61.533%

3 0
3 years ago
Read 2 more answers
Other questions:
  • Deuterium on a periodic table?
    8·1 answer
  • Of the three metals pb cu zn which is the most active
    6·1 answer
  • What does the law of conservation of matter/mass state
    13·2 answers
  • What are atoms made of
    13·1 answer
  • Match the element with its number of valence electrons. Column A 1. Boron : Boron 2. Carbon : Carbon 3. Fluorine : Fluorine 4. S
    13·1 answer
  • How many elements are there
    14·1 answer
  • Which substances will make a salt when combined?
    12·2 answers
  • Which of the following statements best describes a food web?
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • During combustion reaction of propane (C3H8) the amount of CO2 gas was 10 grams. Calculate the mass of burnt propane, oxygen and
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!