If its a unicellular orgnism, it has only one cell . no?
so i guess the answer has to be 1
Answer:
Acceleration is zero.
Explanation:
The slope of a position time graph gives the velocity of the body.
If the slope is constant means the velocity is constant.
Now, acceleration is the measure of the change in velocity of a body over a given time interval.
So, the acceleration of a body is directly proportional to the change in velocity of the body.
If there is no change in velocity, this means that the acceleration of the body is zero.
Here, the slope is a constant implying that the velocity is a constant. So, there is no change in velocity. This implies that the acceleration is zero for the body in the given time interval.
Thus, if a position time graph has a constant slope, one can infer that the acceleration is zero.
Answer:
The atomic mass of gallium (Ga) = <u>69.723 g/mol</u>
Explanation:
Given: Two isotopes of Gallium (Ga) are Gallium-69 (⁶⁹Ga) and Gallium-71 (⁷¹Ga)
<u>For ⁶⁹Ga: </u>
Relative abundance = 60.12% = 60.12 ÷ 100 = 0.6012; Atomic mass = 68.9257 g/mol
<u>For ⁷¹Ga:</u>
Relative abundance = 39.88% = 39.88 ÷ 100 = 0.3988; Atomic mass = 70.9249 g/mol
∴ The atomic mass of Ga = (Relative abundance of ⁶⁹Ga × Atomic mass of ⁶⁹Ga) + (Relative abundance of ⁷¹Ga × Atomic mass of ⁷¹Ga)
⇒ Atomic mass of Ga = (0.6012 × 68.9257 g/mol) + (0.3988 × 70.9249 g/mol) = <u>69.723 g/mol</u>
<u>Therefore, the atomic mass of gallium (Ga) = 69.723 g/mol</u>
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
