1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
2 years ago
8

What are the properties of seismic waves?

Chemistry
1 answer:
natima [27]2 years ago
6 0

Answer: incompressibility, rigidity, and density

Explanation:

You might be interested in
During photosynthesis, the following reaction takes place: carbon dioxide + water + light energy → sugar + oxygen During cellula
Pachacha [2.7K]

Answer:

It cost Evan $17.70 to send 177 text messages. How many text messages did he send if he spent $19.10?

Explanation:

I cant do this

7 0
2 years ago
In an atomic model that includes a nucleus, positive charge is
olganol [36]
<span>Because protons are positively charged and neutrons have no charge then it is safe to say that such an atomic model would have the positive charge concentrated in the center of an atom (option d).</span>
7 0
3 years ago
The central Xe atom in the XeF4 molecule has ________ unbonded electron pair(s) and ________ bonded electron pair(s) in its vale
Dimas [21]

Answer:

Lewis structure in attachment.

Explanation:

Atoms of elements in and beyond the third period of the  periodic table form some compounds in which more than eight electrons surround the  central atom. In addition to the 3s and 3p orbitals, elements in the third period also  have 3d orbitals that can be used in bonding. These orbitals enable an atom to form  an <u>expanded octet</u>.

The central Xe atom in the XeF₄ molecule has <u>two</u> unbonded electron pairs and <u>four</u> bonded electron pairs in its valence shell.

8 0
3 years ago
Exactly how much time must elapse before 16 grams of potassium-42decays, leaving 2 grams of the original isotope?(1) 8 × 12.4 ho
AleksandrR [38]
The answer is <span>(3) 3 × 12.4 hours
</span>
To calculate this, we will use two equations:
(1/2) ^{n} =x
t_{1/2} = \frac{t}{n}
where:
<span>n - number of half-lives
</span>x - remained amount of the sample, in decimals
<span>t_{1/2} - half-life length
</span>t - total time elapsed.

First, we have to calculate x and n. x is <span>remained amount of the sample, so if at the beginning were 16 grams of potassium-42, and now it remained 2 grams, then x is:
2 grams : x % = 16 grams : 100 %
x = 2 grams </span>× 100 percent ÷ 16 grams
x = 12.5% = 0.125

Thus:
<span>(1/2) ^{n} =x
</span>(0.5) ^{n} =0.125
n*log(0.5)=log(0.125)
n= \frac{log(0.5)}{log(0.125)}
n=3

It is known that the half-life of potassium-42 is 12.36 ≈ 12.4 hours.
Thus:
<span>t_{1/2} = 12.4
</span><span>t_{1/2} *n = t
</span>t= 12.4*3

Therefore, it must elapse 3 × 12.4 hours <span>before 16 grams of potassium-42 decays, leaving 2 grams of the original isotope</span>
7 0
3 years ago
Read 2 more answers
NEED HELP with 7. 8. 9. 10. 11. 12. And 14 !!
aleksley [76]

Answer:

1.      0.00040 calories

2.   8.57 calories

3.   0.196 calories

4.  68 calories

5. 243 calories

6.  83680 joules

7.  1,054,368 joules

8. 2.45 calories

9. 556 (it says calories to calories so it wouldn't change)

10. 28367.52 joules

11. 59.6 calories

12. 449.6 joules

13.  0.00234 calories

14. 23292.328 joules

15. 22877693.6 joules

Hope this helps!

Explanation:

6 0
3 years ago
Other questions:
  • The leaves of the rhubarb plant contain high concentrations of diprotic oxalic acid (hooccooh) and must be removed before the st
    10·1 answer
  • What does it mean foe a hypothesis to be testialbe
    10·1 answer
  • The combination of oxygen with other substances to produce new chemical products is called
    15·1 answer
  • Which of the following can be the product of a neutralizationaction?
    9·2 answers
  • A 32 L samples of xenon gas at 10oC is expanded to 35 L. Calculate the final temperature.
    12·1 answer
  • Which of the following best describes what happens when hydrogen and oxygen to form water?
    7·1 answer
  • Argon is an inert gas give reason.​
    5·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Read everything and do everything for brainliest!
    10·1 answer
  • Aspirin is one of the Aesthetic Values of biodiversity<br><br> true<br> false
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!