1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
2 years ago
12

Find the molarity of a 500 L solution that contains 10 moles of fluorine.

Chemistry
1 answer:
deff fn [24]2 years ago
3 0

<u>Given </u><u>:</u><u>-</u>

  • Number of moles = 10
  • Volume of solution = 500L

<u>To </u><u>Find</u><u> </u><u>:</u><u>-</u>

  • Molarity of the solution .

<u>Solution</u><u> </u><u>:</u><u>-</u>

As we know that ,

\longrightarrow Molarity (M )=\dfrac{Number\ of \ moles \ of \ solute }{Volume\ of \ solution\ (in \ L) }

Substitute ,

\longrightarrow M =\dfrac{10}{500L}

Simplify,

\longrightarrow M = \dfrac{1}{50}

Convert into decimal ,

\longrightarrow \underline{\underline{ M = 0.02 \ mol \ L^{-1}}}

This is the required answer .

You might be interested in
How many orbitals in 3rd shell is axial
Firlakuza [10]

Answer:

6 orbitals

Explanation:

you take the total number of orbitals there would normally be and add that to three and you get a total of 6 orbitals in axial.

3 0
3 years ago
Read 2 more answers
The only positive ion found in H2SO4(aq) is the
Hitman42 [59]

The answer is ammonium iron

3 0
3 years ago
Helppppppppppppppppppppp
alukav5142 [94]

decameters - meters: multiply by 10

meters to meters: multiply by 1

centimeters to meters: divide by 100

millimeters to meters: divide by 1000

For the rows at the bottom:

hectometer row: 100, multiply by 100, 4500

decameter row: 10, multiply by 10, 450

meter row: 1, multiply by 1, 45

decimeter row: 0.1, divide by 10, 4.5

centimeter row: 0.01, divide by 100, 0.45

im guessing theres a millimeter row at the bottom:

millimeter row: 0.001, divide by 1000, 0.045


hope this helps!

5 0
3 years ago
The picture shows two containers filled with a gas.
aniked [119]

Answer: The average kinetic energy of the gas particles is greater in container B because it has a higher temperature.

3 0
2 years ago
How many moles of oxygen are required in order to produce 4 moles of<br> water?
Cloud [144]
16 I think hopefully
4 0
3 years ago
Other questions:
  • A rechargeable battery initially stores 3.6 kJ of chemical energy. Anna puts the battery in a flashlight, where 2.1 kJ of energy
    8·1 answer
  • A 25.0 ml sample of a 0.100 m solution of acetic acid is titrated with a 0.125 m solution of naoh. Calculate the ph of the titra
    5·1 answer
  • A 4.5x10 to the negative 3 M solution of a weak acid is 6.3% dissociated at 25%C. In a 4.5x10 to the negative 4 M solution, the
    13·1 answer
  • The meerkat is able to get all of the water in needs through its food and therefore never needs to drink water. This animal is w
    6·1 answer
  • If you have 65.8 grams NH3, how many grams of F2 are required for complete reaction?
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • 3 If methane burns in a poor supply of air it will give carbon
    5·1 answer
  • If you have a sample of a solid with a mass of 48.2 g and a density of 14.3 g/cm3, what would the volume be? (round you answer t
    5·1 answer
  • Which of the following is true for the percentage yield of a reaction?
    9·1 answer
  • Name the following compound: CH₂-C- CH₂-CH₂-CH₂-C - H butanal O2-butanol O propyl hydrogen ether 1-propanone​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!