Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
0.189 g.
Explanation:
- This problem is an application on <em>Henry's law.</em>
- Henry's law states that the solubility of a gas in a liquid is directly proportional to its partial pressure of the gas above the liquid.
- Solubility of the gas ∝ partial pressure
- If we have different solubility at different pressures, we can express Henry's law as:
<em>S₁/P₁ = S₂/P₂,</em>
S₁ = 0.0106/0.792 = 0.0134 g/L and P₁ = 0.321 atm
S₂ = ??? g/L and P₂ = 5.73 atm
- So, The solubility of the gas at 5.73 atm (S₂) = S₁.P₂/P₁ = (0.0134 g/L x 5.73 atm) / (0.321 atm) = 0.239 g/L.
<em>The quantity in (g) = S₂ x V = (0.239 g/L)(0.792 L) = 0.189 g.</em>
<em></em>
Answer:
A) 8.00 mol NH₃
B) 137 g NH₃
C) 2.30 g H₂
D) 1.53 x 10²⁰ molecules NH₃
Explanation:
Let us consider the balanced equation:
N₂(g) + 3 H₂(g) ⇄ 2 NH₃(g)
Part A
3 moles of H₂ form 2 moles of NH₃. So, for 12.0 moles of H₂:

Part B:
1 mole of N₂ forms 2 moles of NH₃. And each mole of NH₃ has a mass of 17.0 g (molar mass). So, for 4.04 moles of N₂:

Part C:
According to the <em>balanced equation</em> 6.00 g of H₂ form 34.0 g of NH₃. So, for 13.02g of NH₃:

Part D:
6.00 g of H₂ form 2 moles of NH₃. An each mole of NH₃ has 6.02 x 10²³ molecules of NH₃ (Avogadro number). So, for 7.62×10⁻⁴ g of H₂:

Answer:
The given statement is true.
Explanation:
The given statement is true.
As per an estimate, to convert graphite into diamond nearly 1 billion to 3.3 billion years of time is required.
Graphite converts into diamond when high-pressure is applied deep in the earth core.
A chemical symbol is a shorthand method of representing an element. Instead of writing out the name of an element, we represent an element name with one or two letters. As you know, the periodic table is a chemist's easy reference guide. ... Each element is represented by a chemical symbol consisting of letters