1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
1 year ago
8

_____________ is an acronym used to refer a family of iron alloys.

Chemistry
1 answer:
Daniel [21]1 year ago
5 0

FeNi or NiFe is an acronym used to refer a family of iron alloys.

<h3>What is alloy?</h3>

An alloy is a mixture of chemical elements that contains at least one is a metal.

<h3>Alloy of iron</h3>

The alloy of iron-nickel can be abbreviated as FeNi, which implies iron-nickel.

where;

  • Fe stands for iron
  • Ni stands for Nickel

Thus, FeNi or NiFe is an acronym used to refer a family of iron alloys.

Learn more about iron alloys here: brainly.com/question/24842164

You might be interested in
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Find the equation of directrix of the parabola is given by 64x equals to -ySquare ​
ANEK [815]

Answer:

Given equation of parabola is

and

2

=64x ......(i)

The point at which the tangent to the curve is parallel to the line is the nearest point on the curve.

On differentiating both sides of equation (i), we get

2 y

dx

d y

=64

⇒

dx

d y

=

and

32

Also, slope of the given line is −

3

4

∴−

3

4

=

and

32

⇒and=−24

From equation (i), (−24)

2

=64x⇒x=9

∴ the required point is (9,−24)

Explanation:

This is the correct answer you want

please follow the

5 0
3 years ago
What is the atomic mass of one mole of H? g/mole
Oksanka [162]
For one mole of hydrogen, H, the atomic mass is 1 g per mole. Hydrogen contains 1 proton and zero neuton. A neutral atom of hydrigen also contains 1 electron.
7 0
2 years ago
Read 2 more answers
How many atoms are in 1.00 mol of calcium
SVEN [57.7K]

Answer: 6.02214076 atoms Ca

Explanation:

Ca is monoatomic, so atoms in 1 mol = avogadro number

6 0
2 years ago
Grade 8 Science
ira [324]
Materials<span> and their </span>properties<span>: </span>compounds like<span> sodium chloride - an interactive educational resource for 11 to 14 year olds. ... Elements are substances (</span>like<span> hydrogen and oxygen) that can't be split into simpler substances. ... For </span>each<span> statement, decide whether it describes a mixture or a </span>compound<span> and check the box.</span>
8 0
3 years ago
Other questions:
  • A 13.0-L helium tank is pressurized to 26.0 atm. When connected to this tank, a balloon will inflate because the pressure inside
    13·1 answer
  • Why charcoal grills or chaecoal fires would not be used to hear the inside of a house
    10·1 answer
  • A lahar is a type of mudflow that occurs
    5·2 answers
  • When the temperature of a gas in a rigid container decreases, the particles of the gas move slower and experience fewer collisio
    15·2 answers
  • sam bought 2 1/4 pounds of swiss cheese 1 1/2 pounds of cheddar at the deli how many pounds of cheese did sam buy altogether
    8·2 answers
  • How do seismologists measure earthquakes?
    15·1 answer
  • What mass of zinc (molar mass 65.4 g moll) does it take to produce 0.50 mole of H2(g)?
    5·1 answer
  • Please help....thanks :)
    5·1 answer
  • What is called exothermic ​
    12·1 answer
  • If the change in Gibbs free energy for a process is positive, the corresponding change in entropy for the universe will be
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!