1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
velikii [3]
3 years ago
10

How does the crystalline structure of a metal differ from the structure of an ionic compound, such as sodium chloride or cesium

chloride?
(answer choices in picture above.)

Chemistry
1 answer:
Sergio [31]3 years ago
7 0

Answer:

The metal cube lattice is made of only one kind of atom.

Explanation:

As we know that metallic crystals are made up of only one kind of element.  A metal crystal is actually a huge sea of positive charges embedded in the layers of negative charges (electrons). The whole crystal is made up of same kind of atoms, e.g crystals of gold, crystals of iron.

If we talk about structure of metallic crystal, it can be body centered cubic, simple cubic, hexagonal or close cubic packing.

Now, coming towards the ionic crystals, we know that they are basically the crystals of ionic compounds like sodium chloride or cesium chloride. These crystals are formed due to ionic bonding between two or more than two kinds of elements/atoms. It is not possible for an ionic crystal to be composed of only one kind of atom. As far as structure is concerned, they can have different structure based on bonding between atoms in an ionic compound, e.g NaCl has octahedral geometry.

Therefore, it is very evident that best option is A.

You might be interested in
33. A basketball bounces on the gym floor nine times and finally comes to a rest. Which of these BEST explains why the
kkurt [141]
The answer is A. good luck.
3 0
3 years ago
the volume of a substance must be measured several time during an experiment. which units should be used to measure the volume o
bija089 [108]

Answer:

Volume is often measured numerically using the International System of Units (SI unit), the cubic meter. for example volume of a cube is measured using a cubic centimeter (cm3), the metric system includes the liter (L) as a unit of volume, where one liter is the volume of a 10-centimeter cube.

3 0
3 years ago
After standardizing a NaOH solution, you use it to titrate an HCl solution known to have a concentration of 0.203 M. You perform
jek_recluse [69]

Answer:

0.203 is the mean of the concentration of the HCl solution

Explanation:

You have 5 concentrations. The most appropiate result is the mean of those results. The mean is a statistical defined as the sum of each result divided by the total amount of results. For the results of the problem, the mean is:

0.210 + 0.204 + 0.201 + 0.202 + 0.197 = 1.014 / 5 =

<h3>0.203 is the mean of the concentration of the HCl solution</h3>
8 0
2 years ago
Which of the following may indicate that a chemical reaction has occurred?
lianna [129]

Answer:

D, all of the above

Explanation:

3 0
2 years ago
What volume of a 2.0M NaOH(aq) is needed to completely neutralize 24 milliliters of 0.5M HCl(aq)?
borishaifa [10]

Answer:

V_{base}=6.0mL

Explanation:

Hello there!

In this case, by considering that the reaction between sodium hydroxide and hydrochloric acid is in a 1:1 mole ratio of these two reactants, we are able to use the following equation relating the concentration and volume of each one:

M_{acid}V_{acid}=M_{base}V_{base}

In such a way, by solving for the volume of the base, we will obtain:

V_{base}=\frac{M_{acid}V_{acid}}{M_{base}} \\\\V_{base}=\frac{0.5M*24mL}{2.0M}\\\\V_{base}=6.0mL

Regards!

8 0
3 years ago
Other questions:
  • The melting point of an ionic solid has a ___ melting point to a molecular solid
    13·1 answer
  • Which list of elements from Period 2 is arranged in decreasing<br> ionization potential?
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Compare the charges and masses of protons neutrons and electrons
    6·1 answer
  • The atomic radii of Li, Na, and Rb are 152 pm, 186 pm, and 244 pm, respectively. What is a reasonable estimate for the atomic ra
    15·2 answers
  • What 2 factors determine whether a collision between reactants is effective
    7·1 answer
  • please let me know if the answer is true or false. if false, please tell me what's false about it. the word that they are wonder
    7·1 answer
  • Are two atoms of the same element identical
    12·1 answer
  • Why does nonmetallic elements pull elements from metallic elements so effectively during a reaction?
    13·1 answer
  • I need help with my work
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!