1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
snow_lady [41]
3 years ago
14

Melissa is interested in her family tree and how her family has changed over its many generations. Melissa probably more closely

resembles
Chemistry
2 answers:
tresset_1 [31]3 years ago
6 0

Answer: A Confucian

Explanation:

In the year 2005, the Guinness Book of World Records recognized the Confucius genealogical line as the longest family tree in history. They have a record of 86 generations over 2,500 years. Confucius (551 to 479 BCE) is believed to have about 3 million descendants all over the world.

So the interest Melissa has in her family tree and also wanting to know how her family has changed over its many generations probably suggests that Melissa more closely resembles a Confucian.

d1i1m1o1n [39]3 years ago
4 0

Answer:

her parents than her great-grandparents.

Explanation:

-w-

You might be interested in
48 When an atom of the unstable isotope Na-24 decays, it becomes an atom of Mg-24 because the Na-24 atom spontaneously releases(
Crank
(1) a beta particle is your answer. Na-24 decays through beta decay, turning a neutron into a proton, electron (beta particle), and an neutrino.
4 0
2 years ago
Which of the following elements would form the smallest ionic radius and why?
AnnyKZ [126]

Answer:

Sodium

Explanation:

5 0
2 years ago
Define solute and solvent ​
dexar [7]
Solute - the substance that dissolves into the solvent to produce a homogenous mixture

Solvent - the substance in which a solute dissolves to produce a homogeneous mixture
5 0
2 years ago
Read 2 more answers
Which of the following is not balanced?
White raven [17]
Is it asking which is or isn’t balanced
7 0
3 years ago
Students conducted an investigation into the three elements listed above. What type of element should Sulfur be labeled?
soldier1979 [14.2K]
MetAllllllllllllllll
7 0
2 years ago
Read 2 more answers
Other questions:
  • Which value indicate the strongest base?<br> 1. pH of 8<br> 2. pH of 5<br> 3. pH of 12
    7·1 answer
  • Calculate the pH of 100.0 mL of a 0.150M aqueous solution of HNO3
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • An accident happens in the lab of Professor Utonium, and a radioactive element X is released in the form of a gas at around 4:00
    8·1 answer
  • Which of these terms best describes the following statement?
    14·1 answer
  • ------ A spring tide can occur..? and anybody help me, please
    11·1 answer
  • In the following pair, determine whether the two represent resonance contributors of a single species or depict different substa
    13·1 answer
  • What is the percent composition of oxygen in BaCrO4
    11·1 answer
  • What is the difference between light photons and infrared photons?
    10·1 answer
  • A can of hairspray is crushed down to half its normal volume. What will
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!