1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalka [10]
3 years ago
14

A decrease in velocity over time A velocity B time C acceleration D deceleration

Chemistry
2 answers:
Nezavi [6.7K]3 years ago
4 0
<span>D deceleration

Hope this helps :)</span>
Lina20 [59]3 years ago
3 0
D is the answer
Hope it helped!
You might be interested in
The lewis dot notation for two atoms is shown. What is represented by this notation? K loses one portion to CI, K gains one port
telo118 [61]

Answer:

K loses one electron to CI

Explanation:

The lewis electron dot notation shows only the chemical symbol of the element surrounded by dots to represent the valence electrons.

  We have atom of K with one valence electrons

   Cl with 7 valence electrons

For an electrostatic attraction to occur, both particles must be charged. To do this, one of the species must lose an electron, and the other gains it.

This will make both species attain a stable octet;

   Hence, K will lose 1 electron and Cl will gain the electrons.

6 0
3 years ago
A 52.0-mL volume of 0.35 M CH3COOH (Ka=1.8×10−5) is titrated with 0.40 M NaOH. Calculate the pH after the addition of 23.0 mL of
Georgia [21]

NaOH reacts with CH3COOH in 1:1 molar ratio to produce CH3COONa 

NaOH + CH3COOH → CH3COONa + H2O 

Mol CH3COOH in 52.0mL of 0.35M solution = 52.0/1000*0.35 = 0.0182 mol CH3COOH 

Mol NaOH in 19.0mL of 0.40M solution = 19.0/1000*0.40 = 0.0076 mol NaOH 

These will react to produce 0.0076 mol CH3COONa and there will be 0.0182 - 0.0076 = 0.0106 mol CH3COOH remaining in solution unreacted . Total volume of solution = 52.0+19.0 = 71mL or 0.071L 

Molarity of CH3COOH = 0.0106/0.071 = 0.1493M 

CH3COONa = 0.0076 / 0.071 = 0.1070M 

pKa acetic acid = - log Ka = -log 1.8*10^-5 = 4.74. 

pH using Henderson - Hasselbalch equation: 

pH = pKa + log ([salt]/[acid]) 

pH = 4.74 + log ( 0.1070/0.1493) 

pH = 4.74 + log 0.717 

pH = 4.74 + (-0.14) 

pH = 4.60.

7 0
3 years ago
What is the correct name for TiF3
trapecia [35]

Answer:

Titanium fluoride

Explanation:

6 0
2 years ago
Read 2 more answers
If your lawn is 21.0 ft wide and 20.0 ft long, and each square foot of lawn accumulates 1350 new snow flakes every minute. How m
klemol [59]
Let us start with the total area of the lawn. Area= width x length, ie, 21 x 20 = 420 sq. ft.   Snow flakes per square foot per minute = 1350  So Snow flakes for 420 sq.feet per minute = 420 x 1350 = 567000.   Snow flakes for 1 hour = 567000 x 60 = 34020000 (60 minutes)  Weight of 34020000 snow flakes = 34020000 x 1.60 = 54432000mg.  To convert it into kilograms, divide this number by 1000000 (1 kilogram = 1000000 milligrams)  Thus 54432000/1000000 = 54.432 kilograms or 54 kilograms and 432 grams.
6 0
3 years ago
Why do you see lightning before you hear the thunder?
krok68 [10]

B,speedof light>speed of sound

8 0
2 years ago
Read 2 more answers
Other questions:
  • List two characteristics used to classify an organism
    9·1 answer
  • What is an output force?
    13·2 answers
  • g a solid organic waste (generic formula: C) is degraded by CO2 by microbial processes. Does this mean C is getting oxidized
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is the strength of alloys and what is the solubility of alloys?
    5·1 answer
  • Which of these compounds is a product of protein synthesis?
    5·2 answers
  • Why is the area called the Fertile Crescent?
    14·1 answer
  • Calculate the amount of F.A.S required to prepare 1000 ml of 0.1 molar standard solution of F.A.S
    13·1 answer
  • Amy set up the following experiment to study how plant growth is influenced by weather conditions. mc052-1 One pot will model no
    13·1 answer
  • Write the step by step process of digestion in ruminants using 4 square method.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!