1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
2 years ago
13

What mass of nitrogen Dioxide, NO2, would be produced by the decomposition of 75.0g of copper (II) nitrate?

Chemistry
1 answer:
-Dominant- [34]2 years ago
7 0
When copper(II) nitrate Cu(NO3)2 decomposition, the final products will determine by temperature. But the ratio of Cu(NO3)2 and NO2 is constant: 1:2. So mole number of 75 g is 0.4 mol. So NO2 is 0.8 mol and is 36.8 g.
You might be interested in
Water has a slight negative charge around its oxygen atom, and a slight positive charge around its hydrogen atoms Which type of
allochka39001 [22]
C.
Water is polar because one side of the molecule is positive and the other is negative.
3 0
3 years ago
Read 2 more answers
Hydrogen can be obtained economically as a byproduct in the electrolysis of
4vir4ik [10]
<span>Hydrogen can be obtained economically as a byproduct in the electrolysis of "brine".
</span>
A solution of sodium chloride (NaCl)and water (H2O) refers to the brine.The procedure of electrolysis includes utilizing an electric current to achieve a synthetic change and make new chemicals. The electrolysis of brine is a huge scale process used to make chlorine from salt, so  three important chemicals, NaOH, Cl2, H2, can be gotten by electrolyzing brine.
8 0
3 years ago
Read 2 more answers
Which agents cause both chemical and physical weathering?
jeka94

Answer:

iron

Explanation:

4 0
3 years ago
you produce 115 grams of water in a combustion reaction. how much methane do you need in grams for this to react?
lora16 [44]

Answer:about 2 grams of methane

Explanation:

idk just got this right

6 0
3 years ago
Two masses exerting a force on each other is an example of What????
trasher [3.6K]

Newtons universal law of gravitation

hope this helps

8 0
3 years ago
Other questions:
  • Which stage of the scientific process enables a scientist to check the work of other
    10·1 answer
  • What kind of change occurs when a compound is separated into its components?
    8·1 answer
  • HELP PLEASE !!!!! which of the following molecules has a bent shape
    12·2 answers
  • Why would a student use rate laws in this investigation
    10·1 answer
  • What is most likely to occur along a transform boundary?
    13·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The element M forms a stable ionic compound MCl 2. If M were allowed to react with bromine, the resulting compound would have th
    6·1 answer
  • The intersection angle of a 3 degree curve is 45.2 degrees. What is the length of the curve? of Select one: O a. 455 m O b.573 m
    12·1 answer
  • A radioactive nucleus emits a beta particle, then the parent and daughter nuclei are
    10·2 answers
  • Why are environmental factors important to consider when assessing an individual’s health? a. environmental factors are the sole
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!