1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ira Lisetskai [31]
3 years ago
13

When sodium carbonate is dissolved in water, it doesn’t dissociate, or break up, completely. There is always some sodium carbona

te in solution. Knowing this, is it a strong or weak base? How do you know?
Chemistry
1 answer:
dusya [7]3 years ago
7 0
It's a weak base because weak bases don't dissociate completely. If it did, then it would be a strong base.
You might be interested in
How many grams are in 0.02 moles of beryllium iodide, Bel2?
Flura [38]
This set up of a conversion table should show you that if you multiply the grams of BeI2 times .02 moles, it equals <span>5.256 g (your answer) </span>

8 0
3 years ago
Aqueous hydrochloric acid will react with solid sodium hydroxide to produce aqueous sodium chloride and liquid water . suppose 1
Aleks04 [339]
The answer is yes I think
5 0
3 years ago
tate whether the following changes are physical or chemical for rancidipication fixation of water 2 tearing of paper 3 rusting o
damaskus [11]

Answer: Physical change : tearing of paper, fixing of wtaer

Chemical change:  rusting of iron ,  electrolysis of water​, Rancidification

Explanation:

Physical change is a change in which there is no rearrangement of atoms and thus no new substance is formed. There is only change in physical state of the substance.

Example:  tearing of paper, fixing of wtaer

Chemical change is a change in which there is rearrangement of atoms and thus new substance is formed. There may or may not be a change in physical state.

Example: rusting of iron ,  electrolysis of water​, Rancidification

3 0
2 years ago
What part of the sun do we see from earth?
NISA [10]

Answer:

photosphere

Explanation:

photosphere

There are 3 main layers of the Sun that we can see. They are the photosphere, the chromosphere and the corona. Together they make up the "atmosphere" of the Sun. The part of the Sun that glows (and that we see with the naked eye) is called the photosphere

8 0
3 years ago
Read 2 more answers
How much pressure does an elephant with a mass of 2200 Kg and a total footprint area of 4500 cm2 exert on the ground?
Debora [2.8K]

Answer:

47911.1 pa

Explanation:

The SI base unit of pressure is pascal, which is N/m^2.

2200 kg is 2200*9.8=21560 N, and 4500 cm^2=4500/10000=0.45 m^2.

So the total pressure exerted on the ground (!!) is 21560/0.45= 47911.1 Pa.

6 0
3 years ago
Read 2 more answers
Other questions:
  • A student decreases the temperature of 556 cm^3 balloon from 278 K to 231 K. Assuming constant pressure, what should the new vol
    10·1 answer
  • What types of elements are shown in the polyatomic ions in model 1?
    12·1 answer
  • Below is mgo. draw the structure of co2 and use curved arrows to show the movement of electron pairs. include lone electron pair
    12·2 answers
  • What is 5L to mL ( chemistry )
    13·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 1. HBr+KOH=? +H2O<br><br> 2. H2SO4+?= (NH4)2SO4 + 2H2O<br><br> 3. ? + Mg(OH)2=Mg(NO3)2+2H2O
    6·1 answer
  • Choose the atom with the largest atomic radius. CI, S, Na,SI
    12·1 answer
  • Conversion of minus 1 coulomb meter in debye
    5·1 answer
  • HELPPP simply the expression!!!!
    10·1 answer
  • What does morality measure
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!