1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nydimaria [60]
3 years ago
6

How many electrons are in an atoms of germanium

Chemistry
2 answers:
sergeinik [125]3 years ago
6 0
The atomic number of germanium is 32 i.e. 32 protons. The number of protons in the nucleus of atom is called atomic number. Germanium has 32 electrons ( 2 electrons in first orbit, 8 electrons in second orbit, 18 electrons in third orbit and 4 electrons in the outermost orbit.
Inessa05 [86]3 years ago
5 0
Answer is , 32 Electrons
You might be interested in
A 1.00 g sample of octane (C8H18) is burned in a bomb calorimeter with a heat capacity of 837J∘C that holds 1200. g of water at
lubasha [3.4K]

Answer:

The heat of combustion for 1.00 mol of octane is  -5485.7 kJ/mol

Explanation:

<u>Step 1:</u> Data given

Mass of octane = 1.00 grams

Heat capacity of calorimeter = 837 J/°C

Mass of water = 1200 grams

Temperature of water = 25.0°C

Final temperature : 33.2 °C

<u> Step 2:</u> Calculate heat absorbed by the calorimeter

q = c*ΔT

⇒ with c = the heat capacity of the calorimeter = 837 J/°C

⇒ with ΔT = The change of temperature = T2 - T1 = 33.2 - 25.0 : 8.2 °C

q = 837 * 8.2 = 6863.4 J

<u>Step 3:</u> Calculate heat absorbed by the water

q = m*c*ΔT

⇒ m = the mass of the water = 1200 grams

⇒ c = the specific heat of water = 4.184 J/g°C

⇒ ΔT = The change in temperature = T2 - T1 = 33.2 - 25  = 8.2 °C

q = 1200 * 4.184 * 8.2 =  41170.56 J

<u>Step 4</u>: Calculate the total heat

qcalorimeter + qwater = 6863.4 + 41170. 56 = 48033.96 J  = 48 kJ

Since this is an exothermic reaction, there is heat released. q is positive but ΔH is negative.

<u>Step 5</u>: Calculate moles of octane

Moles octane = 1.00 gram / 114.23 g/mol

Moles octane = 0.00875 moles

<u>Step 6:</u> Calculate heat combustion for 1.00 mol of octane

ΔH = -48 kJ / 0.00875 moles

ΔH = -5485.7 kJ/mol

The heat of combustion for 1.00 mol of octane is  -5485.7 kJ/mol

8 0
3 years ago
Describe what would happen to the volume of a balloon if it were submerged in hot water
Oliga [24]
The volume of the balloon would decrease
7 0
3 years ago
Is it possible to transfer heat from a cold reservoir to a hot reservoir?
tankabanditka [31]

Answer is: B.) Yes, if work is done, this transfer process can take place.

For example,  air conditioner involves a cyclic process that transfers heat from a cold reservoir to a hot reservoir, but with use of electricity.

Thermal conductuction is the transfer of heat through physical contact. Thermal conduction is the transfer of heat by microscopic collisions of particles. Heat spontaneously flows from a hotter to a colder body.

The process of heat conduction depends on four basic factors: the temperature gradient, the cross section of the materials involved, their path length and the properties of those materials.

8 0
4 years ago
Read 2 more answers
I really need help with this does anybody know how to do this?​
fenix001 [56]

Answer:PLEASE MARK BRAINIEST

The most common method astronomers use to determine the composition of stars, planets, and other objects is spectroscopy. Today, this process uses instruments with a grating that spreads out the light from an object by wavelength. This spread-out light is called a spectrum. Every element — and combination of elements — has a unique fingerprint that astronomers can look for in the spectrum of a given object. Identifying those fingerprints allows researchers to determine what it is made of.

That fingerprint often appears as the absorption of light. Every atom has electrons, and these electrons like to stay in their lowest-energy configuration. But when photons carrying energy hit an electron, they can boost it to higher energy levels. This is absorption, and each element’s electrons absorb light at specific wavelengths (i.e., energies) related to the difference between energy levels in that atom. But the electrons want to return to their original levels, so they don’t hold onto the energy for long. When they emit the energy, they release photons with exactly the same wavelengths of light that were absorbed in the first place. An electron can release this light in any direction, so most of the light is emitted in directions away from our line of sight. Therefore, a dark line appears in the spectrum at that particular wavelength.

Explanation:

8 0
4 years ago
(a) What structural feature is associated with each type of hydrocarbon: alkane, cycloalkane, alkene, and alkyne?
Snowcat [4.5K]

Alkanes are hydrocarbons with straight, saturated branch chains. Ring-shaped hydrocarbons are cycloalkanes. Alkenes are branch chains that are straight and have at least one double bond. Alkynes are branch chains that are straight and have at least one triple bond.

<h3>What is Hydrocarbon ?</h3>

A hydrocarbon is an organic molecule in organic chemistry that is made completely of hydrogen and carbon. Examples of group 14 hydrides include hydrocarbons. The majority of hydrocarbons are colorless and hydrophobic, and their scents are either insignificant or best characterized by those of gasoline and lighter fluid.

Other side effects from certain hydrocarbons include coma, seizures, abnormal cardiac rhythms, and liver or kidney damage. Some solvents used in paints, dry cleaning, and household cleaning solutions are examples of items that contain hazardous hydrocarbons.

To know more about Hydrocarbon please click here : brainly.com/question/3551546

#SPJ4

8 0
2 years ago
Other questions:
  • What do we call compounds that will not dissolve in water
    14·2 answers
  • What is the best course of action if you are out driving during a thunderstorm?
    6·1 answer
  • All atoms of an element always have the same number of question 4 options: electrons protons electrons neutrons save
    8·1 answer
  • Which is true about the dissolving process in water?
    5·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The density of mercury is 13.5g/mL. What is the volume of this liquid if the sample weighs 12.5 pounds?
    13·1 answer
  • Express the concentration of a 0.0350 M aqueous solution of fluoride, F − , in mass percentage and in parts per million (ppm). A
    9·1 answer
  • A gas has a pressure of 25 atm at 303 K . What is the temperature if the pressure drops to 20 atm?
    15·1 answer
  • Which of the following answers is true for the following statement?
    11·1 answer
  • I cant explain this really
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!