1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaK [193]
3 years ago
10

Scientist can use trees to look at climates of the past. How? What information can they gather and how do they gather it? Explai

n.
Chemistry
1 answer:
andrezito [222]3 years ago
6 0

Explanation:

Scientist use trees a whole lot to look at climate of the past by examining tree rings.

These are layers of cambium in each successive years formed. They have an annual growth pattern and are known as tree rings.

Tree rings can be used to decipher the age of a tree.

  • These three rings can be used to interpret climatic patterns.
  • During a wet climate, the tree rings are more robust and bigger.
  • In a dry climate, the rings are thinner.
  • These alternating patterns can be used to decipher the climatic signatures in a tree.
  • Sometimes, it is possible to evaluate some certain isotopes that are useful in climatic studies.

learn more:

Climate change brainly.com/question/7824762

#learnwithBrainly

You might be interested in
The energy stored in foods and fuels is?
elixir [45]
Chemical potential energy
5 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Every element has a unique amount of
tamaranim1 [39]
Protons is the answer
5 0
3 years ago
Motion is... Question 1 options: A change in speed over a certain amount of time. A change in position over a certain amount of
Pie
A change in position over a cetain time
6 0
3 years ago
Why is methane, CH4, a nonpolar compound?
Tom [10]
Each covalent H bond is nonpolar.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Steps to identify a mineral
    6·1 answer
  • What are reactants of nuclear fission
    12·1 answer
  • The electron cloud model describes the _____ of electrons in an atom.
    12·2 answers
  • Which phrase best describes how scientists use the data they collect
    7·2 answers
  • What is the total number of hydrogen atoms in a molecule of heptyne?
    15·1 answer
  • Describe the experiment to prove Ohm's law ​
    5·2 answers
  • What is Molecule made off?<br><br>a) Electrons<br>b) Protons<br>c) Atoms<br>d) Nuclei​
    11·2 answers
  • Answer ASAP Pls don't use links
    8·1 answer
  • Help with science!!!!
    12·1 answer
  • What is the ATOMIC NUMBER for an element with 5 protons, 6 neutrons and 2 electrons?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!