1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
3 years ago
6

Which substance can be broken down by chemical means?

Chemistry
1 answer:
sp2606 [1]3 years ago
7 0
The substance that can be broken down by chemical means from the choices given is CO (Carbon monoxide). Carbon monoxide is a compound made up of carbon and oxygen and can therefore be broken by chemical means.
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
The wax of a burning candle is a fuel that combines with oxygen in the air. As the fuel is consumed, what happens to most of the
Molodets [167]
D. It is released as heat and light.
7 0
3 years ago
Read 2 more answers
How many moles of silver chloride, produced from 100 g of silver nitrate reacting with barium chloride BaCl2?
Dmitrij [34]

Answer:

Equation of Reaction

2AgNO3 + BaCl2 === 2AgCl + Ba(NO3)2

Molar Mass of AgNO3 = 170g/mol

Moles of reacting AgNO3 = 100g/170gmol-¹

=0.588moles of AgNO3

From the equation of reaction...2moles of AgNO3 reacts to Produce 2Moles of Silver Chloride

So Their ratio is 2:2.

This means that 0.588Moles of AgCl Will be produced too.

ANSWER...0.588MOLES OF AgCl WILL BE PRODUCED.

7 0
3 years ago
How do ocean currents (specifically ocean gyres) impact climate
Alex73 [517]

Answer:

Because ocean currents circulate water worldwide, they have a significant impact on the movement of energy and moisture between the oceans.

Explanation:

8 0
3 years ago
Read 2 more answers
What is the total pressure exerted by a mixture of 48.0 grams of CH4 and 56.0 grams of
Oksi-84 [34.3K]

The pressure of the gas is obtained as 48 atm.

<h3>What is the total pressure?</h3>

Now we know that;

Number of moles of CH4 = 48.0 grams /16 g/mol = 3 moles

Number of moles of H2 =  56.0 grams/2 g/mol = 28 moles

Total number of moles present = 3 moles + 28 moles = 31 moles

Using;

PV =nRT

P = total pressure

V = total volume

n = total number of moles

R = gas constant

T = temperature

P = nRT/V

P = 31 * 0.082 * 286/15

P = 48 atm

Learn more about pressure of a gas:brainly.com/question/18124975

#SPJ1

4 0
1 year ago
Other questions:
  • WILL MARK BRAINLIEST! ANSWER QUICKLY!!!!
    13·2 answers
  • Which has most likely been peer reviewed?
    6·1 answer
  • Al2(SO3)3 what are the number of atoms
    15·1 answer
  • A common function of proteins and carbohydrates in the plasma membrane is...
    7·1 answer
  • An element has three stable isotopes with masses of 27.977 amu, 28.976 amu, and 29.973 amu. The heavier two isotopes have an abu
    7·1 answer
  • What is the common name of sodium bicarbonate
    15·1 answer
  • How does your pattern of breathing change when you exercise and then rest ?​
    13·1 answer
  • Helpppppppppppppppppppppppppppp
    9·1 answer
  • Whats the answer giving brainliest have a good day lol help
    15·1 answer
  • If half of the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!