1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreas93 [3]
3 years ago
10

Enter ionic and net equations: feso4(aq)+ na3po4(aq) arrow fe3(po4)2(s)+na2so4(aq)

Chemistry
1 answer:
stepan [7]3 years ago
6 0

Answer:

<em> ionic equation : </em>3Fe(2+)(aq) + 3SO4(2-)(aq)+ 6Na(+)(aq) + 2PO4 (3-) (aq) → Fe3(PO4)2(s)+ 6Na(+) + 3SO4(2-)(aq)

<em> net ionic equation: </em>3Fe(2+)(aq)  + 2PO4 (3-)(aq) → Fe3(PO4)2(s)

Explanation:

The balanced equation is

3FeSO4(aq)+ 2Na3PO4(aq) → Fe3(PO4)2(s)+ 3Na2SO4(aq)

<em>Ionic equations: </em>Start with a balanced molecular equation.  Break all soluble strong electrolytes (compounds with (aq) beside them) into their ions . Indicate the correct formula and charge of each ion. Indicate the correct number of each ion . Write (aq) after each ion .Bring down all compounds with (s), (l), or (g) unchanged. The coefficents are given by the number of moles in the original equation

3Fe(2+)(aq) + 3SO4(2-)(aq)+ 6Na(+)(aq) + 2PO4 (3-) (aq) → Fe3(PO4)2(s)+ 6Na(+) + 3SO4(2-)(aq)

<em>Net ionic equations: </em>Write the balanced molecular equation.  Write the balanced complete ionic equation.  Cross out the spectator ions, it means the repeated ions that are present.  Write the "leftovers" as the net ionic equation.

3Fe(2+)(aq)  + 2PO4 (3-)(aq) → Fe3(PO4)2(s)

You might be interested in
What is the formula for the compound made from mercury (II) and the nitrate ion.
Kazeer [188]

Answer:

Hg(NO3)2

Explanation:

Hope it helps! :)

5 0
2 years ago
Read 2 more answers
PLEASE ANSWER ASAP <br> please get it right
musickatia [10]

Answer: C

Earths atmosphere maintains a stable temp

4 0
3 years ago
Is calcium more reactive than lead?
exis [7]

Answer:

Yes Calcium is more reactive than Lead.

Explanation:

5 0
2 years ago
Read 2 more answers
How can a solution become saturated?
vladimir2022 [97]

Answer:

it think it is more solute added

7 0
2 years ago
Read 2 more answers
What happens when the student use a straw to blow a stream of air between the papers?
klasskru [66]

Actualy the answer is Lower pressure causes the papers to come closer together.

Please mark brainiest if this is correct and helpful.

3 0
3 years ago
Other questions:
  • Read the following, and answer the questions below. Remember to read the question carefully.
    9·1 answer
  • If 28.0 grams of Pb(NO3)2 react with 18.0 grams of NaI, what mass of PbI2 can be produced? Pb(NO3)2 + NaI → PbI2 + NaNO3
    15·1 answer
  • Suppose you used 2.613 g of THAM to make the 250 mL THAM solution and it took 38.58 mL of your unknown HCl solution to reach the
    12·1 answer
  • If a black hole is invisible how can we determine when one is present
    12·1 answer
  • DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
    6·1 answer
  • A container holds 1 mole of helium gas. The volume of the container is 2 liters and the pressure inside the container is 105.0 k
    11·1 answer
  • Based on Reference Table I, the formation of 1 mole of which of the following substances releases the greatest amount of energy?
    11·2 answers
  • Question 4
    5·1 answer
  • An exploratory robot was sent to the planet mars. The gravity on mars is weaker than the gravity on earth. Compared to the mass
    6·1 answer
  • What is diffusion ,?? ​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!