1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
6

A negatively charged rod of finite length carries charge with a uniform charge per unit length. Sketch the electric field lines

in a plane containing the rod.

Physics
1 answer:
stiv31 [10]3 years ago
3 0

Answer:

In the case of a negatively charged rod, the field lines points radially towards the rod.

Explanation:

Field lines pointing towards the negatively charged rod are used to represent the nature of an electric field. Field lines always points in a direction, i.e If the charge is positive, field lines points radially away from the rod and if the charge is negative the field lines points radially towards the rod. So in the case of a negatively charged rod, the field lines points radially towards the rod.

You might be interested in
What is the relationship between the temperature of a star and its luminosity?
Sladkaya [172]
The Luminosity of a star is proportional to its Effective Temperature to the 4th power and its Radius squared.
3 0
3 years ago
PLEASE HELP ME!!!! i will give brainliest to whoever gets it right
Oksanka [162]

Answer:

I believe the answer is B.)

6 0
3 years ago
The minute hand of a wall clock measures 16 cm from its tip to the axis about which it rotates. The magnitude and angle of the d
olya-2409 [2.1K]

Answer:

Explanation:

Given

Minute hand length =16 cm

Time at a quarter after the hour to half past i.e. 1 hr 45 min

Angle covered by minute hand in 1 hr is 360 and in 45 minutes 270

|r|=\frac{3\times 2\pi r}{4}=75.408 cm

Angle =270^{\circ}

(c)For the next half hour

Effectively it has covered 2 revolution and a quarter

|r|=\frac{2\pi r}{4}=25.136 cm

angle turned =90^{\circ}

(f)Hour after that

After an hour it again comes back to its original position thus displacement is same =25.136

Angle turned will also be same i.e. 90 ^{\circ}

7 0
3 years ago
A car moves with constant velocity along a straight road. Its position is x1 = 0 m at t1 = 0 s and is x2 = 66 m at t2 = 6.0 s .
UNO [17]

Answer: 1. 33, 2. 264

Explanation: 66m= 6s so, to find the position at 3s you just need to take 66/2 = 33m cause 3 is half of 6. & for 2 you will take 66x4= 264m cause it took 4s multiply by the original 6s to get 24s. Answer: 1 is 33m and 2 is 264m

7 0
3 years ago
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC
igor_vitrenko [27]

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

7 0
3 years ago
Other questions:
  • What is the weight of a 42 kg object if the object was on the moon?
    7·1 answer
  • In an inertia balance, a body supported against gravity executes simple harmonic oscillations in a horizontal plane under the ac
    13·1 answer
  • The transfer of heat is through direct contact of particles is called
    13·1 answer
  • A plane flies at 200 m/s, emitting a 600 Hz roar. Assuming a 340 m/s speed of sound, what will be the frequency of sound waves h
    11·1 answer
  • Two sections, A and B, are 0.5 km apart along a 0.05 m diameter rough concrete pipe. A is 115 m higher than B, the water tempera
    14·1 answer
  • You are the driver of the car in the photos above. You Are traveling at 30 mph when suddenly the car goes from its position in t
    6·1 answer
  • How can you use ecozone in a sentence?
    7·1 answer
  • When performing Tai Chi, The breathing technique utilized is called “Belly Breathing”
    7·1 answer
  • What process is mostly responsible for the blue appearance of the sky
    9·1 answer
  • A boy exerts an unknown horizontal force as he pulls a 52 N sled across packed snow. The coefficient of friction is 0.12. If a p
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!