1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grigory [225]
3 years ago
15

If greenhouse gases in the atmosphere act like a blanket around the Earth, how is this "blanket” being changed by human activiti

es?
Chemistry
2 answers:
Mnenie [13.5K]3 years ago
5 0

Answer:

in other words: It is getting thicker and keeping the Earth warmer.

Afina-wow [57]3 years ago
4 0
The gases we create are adding to that blanket making sun light harder to escape,so the world heats up due to this addition to the layer 
You might be interested in
1 point<br> How many moles of CO2 are there in 100.0 grams of CO2?
VikaD [51]

44.0095 you're welcome hope this helps

3 0
3 years ago
Read 2 more answers
The impact of science and technology on society is evident. But society also influences science. There are social influences on
lbvjy [14]

Answer:

yea that

Explanation:

5 0
3 years ago
Express the following in scientific notation:<br><br> 1. 158000 km<br> 2. 0.000009782 L
slamgirl [31]

Answer:

1.58x10^5km

9.782x10^-6

Explanation:

Please Brainlist

6 0
2 years ago
What are the solutions to the equation x2 + 4x + 5 = 0?​
dusya [7]

Answer:

-1, -4

Explanation:

x^2+4x+5=0

Factoring, you get:

(x+4)(x+1)=0

To find what x can be, you need to realize what could make this equation true. To set the left side equal to 0, either one of the terms in parentheses must be equal to 0. To do that, x must be the negative of the other term, so that they can cancel each other out. Therefore, x is -4 and -1. Hope this helps!

4 0
3 years ago
Read 2 more answers
How much space does 1 mole of any gas occupy?
denpristay [2]
Facebook app app and Facebook app
7 0
3 years ago
Other questions:
  • How much energy is required to vaporize 0.5kg of water?
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which statement correctly compares sound and light waves?
    11·1 answer
  • Directions: Name each of the following compounds. If a name is given, write the formula.
    8·1 answer
  • Which element has the greatest average atomic mass?
    6·1 answer
  • Define An Atom.<br>Ty!!!​
    15·2 answers
  • Which of the following is NOT a true about atomic mass?
    6·1 answer
  • Balance the equation
    13·1 answer
  • A chemical reaction in which bonds are broken is usually associated with ________. a chemical reaction in which bonds are broken
    11·1 answer
  • What are levers used for? (science)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!