1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
3 years ago
8

Complete the following conversion. 25.0 °C = °F

Chemistry
2 answers:
s2008m [1.1K]3 years ago
7 0

Answer:

Hey!

25.0 C to F is now 77 F

Explanation:

TO CONVERT C TO F...

Celsius to Fahrenheit, multiply by 1.8 and add 32!

SO...

25.0 x 1.8 = 45

45 + 32 = 77

ANSWER = 77 F

HOPE THIS HELPS!!

olga nikolaevna [1]3 years ago
4 0

Answer: 25°C=77°F

Explanation:

FORMULA

F=9/5 C+32

-----------------------------------

Given: C=25°

F=9/5 C+32

F=9/5 (25)+32

F=45+32

F=77°

Hope this helps!! :)

Please let me know if you have any question

You might be interested in
True or False
goldenfox [79]

Answer:

I believe its True

4 0
3 years ago
Read 2 more answers
PLEASE HELP!
KatRina [158]
Hello the answer is c love
7 0
3 years ago
Read 2 more answers
Indentify this reaction <br> C+ S8--&gt;CS2
labwork [276]

Answer:

4C + S8 → 4CS2

Explanation:

5 0
3 years ago
How many moles of oxygen are in 25.45 g of caco3?
emmainna [20.7K]
From the periodic table:
mass of oxygen = 16 grams
mass of calcium = 40 grams
mass of carbon = 12 grams
mass of CaCO3 = 40 + 12 + 3(16) = 100 grams
Therefore, each 100 grams of CaCO3 contains 3 moles of oxygen
To know the number of oxygen moles in 25.45 grams, we will simply do cross multiplication as follows:
number of oxygen moles = (25.45 x 3) / 100 = 0.7636
3 0
3 years ago
How are selective breeding, cloning, and genetic engineering similar? They are all controlled by nature. They are all controlled
sveticcg [70]

Answer:They are all controlled by the human beings.

Explanation:

The selective breeding, cloning and genetic engineering are some of the techniques which is induced by the human efforts.

In case of selective breeding the male and female species having the selective characters are mated with each other so that the offspring produced  has the desired characters. It neither requires any enzyme nor uses udder cells.

In case of genetic engineering, the gene of interest is inserted in the bacterial species by the help of vector so that when the bacterial species amplify the gene of interest. This is how the desired products are produced by bacterial species. Example: Insulin production.

Cloning can be defined as another technique made by human beings in which the genetically identical species is made naturally or artificially for the benefit of the mankind.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What are the first five elementsof the periodic table?
    7·1 answer
  • Hemoglobin, the oxygen-carrying protein in red blood cells, has four iron atoms per molecules ad contains 0.340 percent iron by
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Sodium permanganate and iron(III) chloride are both dissolved in a beaker of water. In a double displacement reaction, two new p
    13·1 answer
  • When iron metal reacts with sulfuric acid, it produces iron (III) sulfate and hydrogen gas. Balance the equation: Fe + H2SO4 → F
    11·1 answer
  • What is the speed of a man that travels 2 meters in 6.5 seconds?
    12·2 answers
  • What does vegetative propagation mean?​
    7·1 answer
  • B) How many kilograms of carbon dioxide are formed when 24.42 g of iron is<br> produced?
    5·1 answer
  • If a sample containing 18.1 g of NH3 is reacted with 90.4 g of
    9·1 answer
  • 1. How is the atom count for each element on the reactant side of a balanced chemical equation related to the atom count for eac
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!