1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rusak2 [61]
3 years ago
11

The volume of a gas is 0.30 L when the pressure is 4.00 atm. At the same temperature,

Chemistry
1 answer:
padilas [110]3 years ago
7 0

Answer:

The presion is 0.6 atm

Explanation:

P1V1=P2V2

P2 = P1V1/V2

P2 = (4.00 atm * 0.30 L) / 2.0 L

P2= 0.6 atm

You might be interested in
How many moles of sodium atoms do you have if you have 5.60 ~
Papessa [141]

Answer:

0.93 mol

Explanation:

Given data:

Number of moles of Na atom = ?

Number of atoms = 5.60× 10²³

Solution:

Avogadro number:

The given problem will solve by using Avogadro number.

It is the number of atoms , ions and molecules in one gram atom of element, one gram molecules of compound and one gram ions of a substance. The number 6.022 × 10²³ is called Avogadro number.

1 mole = 6.022 × 10²³ atoms

5.60× 10²³ atoms ×  1 mol / 6.022 × 10²³ atoms

0.93 mol

3 0
3 years ago
Which of these is an example of a chemical change?
goblinko [34]
C. Digesting a sandwich


Is your answer

Hope this helps
3 0
4 years ago
Read 2 more answers
Which of the following an ionic bond like what holds Na+ and Cl- together in NaCl?
galina1969 [7]

Answer:

Rb

Explanation:

Rb look closely

8 0
3 years ago
Read 2 more answers
Which describes any compound that has at least one element from group 17?
Contact [7]
The answer is HALIDE.
6 0
3 years ago
State how you can tell from a dot and cross diagram that the particles in a compound are held together by ionic bonds
Darina [25.2K]

Answer:

In diagram you have to show the electrons(dots) near to the more electronegative element by this you can show that this is an ionic bond.

Explanation:

8 0
3 years ago
Other questions:
  • How many moles of Fe2O3 are in 209 g of the compound?
    13·1 answer
  • Which substance would you most likely need to cool to the lowest temperature before it condenses?
    14·2 answers
  • What is the break down of food into energy
    13·1 answer
  • How many minutes will it take to plate out 4.50 g of Cu from a solution of Cu(NO3)2 (aq) onto the cathode of an electrolytic cel
    10·1 answer
  • What is it called when you apply science and mathematics to real life problems
    9·1 answer
  • 5.0 gram of anhydrous calcium carbonate is reacted with an excess of dilute nitric acid. if the reaction is carried out at 25 de
    5·1 answer
  • What does phenolphthalein turn pink?
    15·1 answer
  • What are the favored geometrical arrangements for abn molecules for which the a atom has 2?
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • The diagram shows a model of an atom. Who first proposed this model?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!