1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
3 years ago
13

Which is a density independent factor limiting popultion growth

Chemistry
1 answer:
shusha [124]3 years ago
3 0

The amount the amount of space a population has to grow in would be a limiting factor.


You might be interested in
Balance this redox reaction occurring in acidic media:
Lelu [443]
Add 7 water atom to the right hand side to adjust the quantity of oxygen. Increase Cr(+3) by two to adjust the quantity of Cr. Duplicate Cl-by two to adjust the quantity of chlorine molecules. 
Cr2O7[2-](aq) +2 Cl[-](aq) < - >2 Cr[3+] (aq) + Cl2(g)+7H2O 
Presently adjust that charges. 
you have - 4 charges on the left hand side, while +18 charges on the right hand side, there for include 14H+ the left hand side to adjust the charges 
Cr2O7[2-](aq) +2 Cl[-](aq)+14H+ < - >2 Cr[3+] (aq) + Cl2(g)+7H2O 
take note of that the oxidation number of hydrogen in water is +1
3 0
3 years ago
Question 2
Thepotemich [5.8K]

Answer:

1-Pentene

Explanation:

If we look at all the options listed, we will notice that the rate of reaction of bromine with each one differs significantly.

For 1-pentene, addition of bromine across the double bond is a relatively fast process. It is usually used as a test for unsaturation. Bromine water is easily decolorized by alkenes.

Cyclohexane, heptane are alkanes. They can only react with chlorine in the presence of sunlight. This is a substitution reaction. It does not occur easily. A certain quantum of light is required for the reaction to occur.

For benzene, bromine can only react with it by electrophilic substitution in which the benzene ring is retained. A Lewis acid is often required for the reaction to occur and it doesn't occur easily.

3 0
3 years ago
Consider the Fischer ester synthesis of methyl benzoate from benzoic acid and methanol in the presence of sulfuric acid as a cat
zlopas [31]

Answer:

48.8%

Explanation:

The reaction has a 1:1 mole ratio so;

Number of moles of benzoic acid reacted = mass/molar mass = 3.8 g/122.12 g/mol = 0.03 moles

So;

0.03 moles of methyl benzoate is formed in the reaction

Mass of methyl benzoate formed = 0.03 moles * 136.15 g/mol = 4.1 g

percent yield = actual yield/theoretical yield * 100/1

percent yield = 2.0 g/4.1 g * 100 = 48.8%

4 0
3 years ago
Balance the following chemical equation, then answer the following question.
julsineya [31]
Molar mass:

O2 = 31.99 g/mol
C8H18 = 144.22 g/mol

<span>2 C8H18(g) + 25 O2(g) = 16 CO2(g) + 18 H2O(g)

2 x 144.22 g --------------- 25 x 31.99 g
10.0 g ----------------------?? ( mass of O2)

10.0 x 25 x 31.99 / 2 x 144.22 =

7997.5 / 288.44 => 27.72 g of O2

hope this helps!


</span>

3 0
3 years ago
During a titration the following data were collected. A 50.0 mL portion of an HCl solution was titrated with 0.500 M NaOH; 200.
Travka [436]

<u>Answer:</u> The mass of HCl present in 500 mL of acid solution is 36.5 grams

<u>Explanation:</u>

To calculate the concentration of acid, we use the equation given by neutralization reaction:

n_1M_1V_1=n_2M_2V_2

where,

n_1,M_1\text{ and }V_1 are the n-factor, molarity and volume of acid which is HCl

n_2,M_2\text{ and }V_2 are the n-factor, molarity and volume of base which is NaOH.

We are given:

n_1=1\\M_1=?M\\V_1=50.00mL\\n_2=1\\M_2=0.500M\\V_2=200.mL

Putting values in above equation, we get:

1\times M_1\times 50.00=1\times 0.500\times 200\\\\M_1=\frac{1\times 0.500\times 200}{1\times 50.00}=2M

To calculate the mass of solute, we use the equation used to calculate the molarity of solution:

\text{Molarity of the solution}=\frac{\text{Mass of solute}\times 1000}{\text{Molar mass of solute}\times \text{Volume of solution (in mL)}}

Molar mass of HCl = 36.5 g/mol

Molarity of solution = 2 M

Volume of solution = 500 mL

Putting values in above equation, we get:

2mol/L=\frac{\text{Mass of solute}\times 1000}{36.5g/mol\times 500}\\\\\text{Mass of solute}=\frac{2\times 36.5\times 500}{1000}=36.5g

Hence, the mass of HCl present in 500 mL of acid solution is 36.5 grams

4 0
3 years ago
Other questions:
  • There are a few different shapes of airplanes being considered in the design of a new airplane. One design would add protrusions
    11·1 answer
  • Why is it important to balance a chemical equation
    15·2 answers
  • The molar mass of argon is 40g / mol what is the molar mass of a gas if it effuses at 0.91 times the speed of argon gas
    12·1 answer
  • how many moles of potassium hydroxide are needed to completely react with 1.73 miles of aluminum sulfate according to the follow
    10·2 answers
  • How do acids and bases affect molecules such Proteins? ​
    15·1 answer
  • How can u use invade in a sentence using science terms?
    15·1 answer
  • Did you know An apple, potato, and onion all taste the same if you eat them with your nose plugged , CRAZYYYYYYYYY
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • A pressure gauge at elevation 12m at the side of a tank containing a liquid reads 80 kpa. Another gauge at elevation 7m reads 12
    6·1 answer
  • Determine the empirical formula of a compound that was found to contain 6.412 g potassium, 2.292 g n, and 7.871 g o.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!